Team:Xiamen City/Experiments
Overview
We supposed that E.coli will undergo an adaptive evolution, surviving under the environment with m-phenylenediamine and even degrade it by consuming or decomposing m-phenylenediamine for energy or carbon and nitrogen. And the addition of signal peptide sequence is fused with key enzyme may improve the degradation efficiency. Therefore, we aimed to continue our previous experiment and test whether m-phenylenediamine could be successfully degraded from the change in colors. We divided our experiments into mainly five parts:
1.We tested the adaptive evolution with E. coli for m-phenylenediamine degradation.
2.We constructed the bpul expression E. coli for m-phenylenediamine degradation.
3.We constructed and measured the expression of GFP in the construction of type IIS. (Collaboration with Shanghai_HS_United)
4.We identified the strain of sludge bacteria.
5.We constructed the secretion of proteins by constructing signal peptides plasmid (GFP). (Collaboration with Shanghai_City)
1.Adaptive Evolution with E. coli for m-phenylenediamine degradation
(1)The proliferation of E.coli
A.LB culture medium
Material: bacto-tryptone (5 g), bacto-yeast extract (2.5 g), NaCl (5 g), double distilled H2O (500 ml)
Experimental apparatus: pipette, centrifuge tube (50 ml), autoclave, electronic balance, lab spoon, weighing paper, 1000ml conical flask, measuring cylinder, ultrasonic instrument, glass rod, clean bench
Step:
a.Put a piece ofweighing paper on the electronic balance, and use the electronic balance to acquire the appropriate mass of solid material. After that, transfer the material into a conical flask.
b.Use the measuring cylinder to measure 500 ml double distilled H2O. Then, pour the water into the conical flask, and blend the mixtures with glass rod.
c.Use the ultrasonic instrument to dissolve the solid from the flask. Shake the conical flask while doing this.
d.After the solid was totally dissolved in the water, cover the top of the conical flask and seal it with rubber band. Then, put the conical flask into autoclave, heat the bottle at 121 ℃ for 20 min.
B.Separate the culture medium into three 50 ml centrifuge tubes and inject 200 μl solution of E.coli and laboratory evolutionary strains with pipette. Cover the centrifuge tube with its lid.
C.Cultivate the bacteria in the shaking table for 1 day at 37 ℃
D.Step B should be done on clean bench. Whenever open or close the centrifuge tube, the lid and the top of the tube should be heated by alcohol burner for few seconds.
(2) The construction of system for adaptive evolution
Material: LB culture medium (8 ml *18+45 μl *15), solution of E.coli and bacteria from sludge, 100 mM m-phenylenediamine solution(5 μl*4),
Experimental apparatus: pipette, EP tube, centrifuge tube(15 ml*18), clean bench
Step:
a.Use the pipette to transfer 8ml solution of the solution of bacteria to each of the centrifuge tube(12 tubes for bacteria from sludge, 6 tubes for E.coli)
b.Calculate the amount of substance of m-phenylenediamine that was needed for 8ml solution with the Molarity of 50μM, 5μM, 0.5μM, 0.05μM, 0, and control group. Clearly mark each centrifuge tube with accurate molarity, species of the bacteria, date, and time (07.23.2019 15:00).
c.To decrease the error, it is better to add same volume of m-phenylenediamine solution (40 ul) with different molarity.
d.After adding m-phenylenediamine, make a 200 μl sample in EP tube for each centrifuge tube. Clearly mark note on each EP tube with accurate molarity, species of the bacteria, date, and time. Store those samples in fridge at -20℃
e.Use LB culture medium to refill 50 ml centrifuge tubes. Put the centrifuge tubes back into shaking table to cultivate bacteria.
f.Sample every centrifuge 200 μl at the same time each day.
g.Add the same amount of m-phenylenediamine to centrifuge tubes each day at the same time.
Material: MgSO4.7H2O, CaCl2.2H2O, Na2HPO4.7H2O, NaCl, KH2PO4, NH4Cl, double distilled H2O, m-phenylenediamine solution(1M)
Experimental apparatus: pipette, centrifuge tube (15 ml), electronic scales, pan paper, spoon, autoclave, 1000 ml conical bottle, measuring cylinder, μltrasonic instrument, conical bottle
Step:
a.Put a piece of pan paper on the electronic scales, and use the electronic scales to acquire 2.46 g MgSO4.7H2O. Transfer it to centrifuge tube and use pipette to add 10ml double distilled water into the centrifuge tube.
b.Replace a new piece of pan paper on the electronic scales and use the electronic scales to acquire 1.47 g CaCl2.2H2O. Transfer it to a new centrifuge tube and use pipette to add 10ml double distilled water into the centrifuge tube.
c.Replace a new piece of pan paper on the electronic scales and use the electronic scales to acquire 12.8 g Na2HPO4.7H2O, 3.0 g KH2PO4, 0.5 g NaCl, and 1.0 g NH4Cl. Transfer it to 1000ml conical bottle and use measuring cylinder to measure and add 200 ml double distilled water into the conical bottle.
d.Calculate the amount of m-phenylenediamine needed. According to the original formula, 4 g glucose is needed for the culture medium. However, we need to replace the carbon source in glucose with carbon in m-phenylenediamine, which means there should be the same amount of carbon in m-phenylenediamine as the amount of carbon in glucose.
4g*(72/180)=xL*1M*72g/mol => x
e.Use the measuring cylinder to acquire the volume of phenylenediamine solution, pour the solution in to a centrifuge tube
f.Put them in autoclave to eliminate all microorganism. Set the temperature at 121℃ for 15min
g.After eliminating microorganism, mix four solution together.
h.Use the same method as we do when separating the LB culture medium
(3)Find the minimal inhibitory concentration
Material: LB culture medium, solution of E.coli, solution of bacteria from sludge, m-phenylenediamine (100 mM)
Experimental apparatus: pipette, centrifuge tube (15 ml), clean bench,
96-well plate, ELIASA,
Step:
a.Use the pipette to transfer 8ml solution of the solution of bacteria to each of the centrifuge tube (12 tubes for bacteria from sludge, 6 tubes for E. coli)
b.Calculate the amount of substance of m-phenylenediamine that was needed for 8ml solution with the Molarity of 50 μM, 5 μM, 0.5 μM, 0.05 μM, and 0.
Clearly mark each centrifuge tube with accurate molarity, species of the bacteria, date, and time (07.21.2019 16:00).
c.Use the same way that we used when constructing system for adaptive evolution to add m-phenylenediamine solution to centrifuge. (See the figure in part adaptive evolution)
d.Measure the optical density (OD) of sample the same time each day, record the data.
A.Use pipette to sample 200 ul of each tube and LB culture medium.
B.Use ELIASA to measure OD. Set the process—shaking 5 s, 595 nm
(4)HPLC detection
First, we established a method for the m-phenylenediamine using HPLC machine.
The peak about 9 min is m-phenylenediamine standard.
We used different concerations of m-phenylenediamine (50 μM, 5 μM, 0.5 μM, 0.05 μM, and 0) for adaptive evolution.
2.Construction of the E.coli expression bpul for m-phenylenediamine degradation
(1)Plasmid construction
The first step of our project was to design the plasmid and its corresponding primers. We used pSB1C3-pbul-R and pSB1C3-pbul-F as primers, P6 High-Fidelity Polymerase, and K1-1 for its vector; bpul-F and bpul-R as primers, P6 High-Fidelity Polymerase, and K13 for its plate. After we constructed the plasmid well, we detected the molecular weight by DNA gel electrophoresis. The standard molecular weight of vector K1-1 is 2287bp, and the target gene K13 should be 1557 bp. Using 5000 bp DNA molecular marker as a scale, we found that amplified fragments were correct. The concentration of the target fragment recovered by DNA recovery column was 4.2 ng/ul, and that of the vector was 12.8 ng/ul.
When the exogenous DNA fragments and vector were recovered successfully, we recombined the target fragment and vector by Ezmax recombinase and 5X Buffer for Ezmax One-Step. After the recombinant system was prepared, placed it in 37 Celsius water-bathed for 30 minutes and stopped in ice-bathed for 5 minutes. Subsequently, added the reaction system into the competent cells with pipette. Ice-bathed for 30 minutes, then water bath for 90 seconds in 42 Celsius. Another ice-bathed for 2 minutes, then added the LB medium into the centrifugal tube which contained the combination of the reaction system and competent cells. Resuscitated it in 37 Celsius Shaker. Later, inoculated the cells on a solid medium containing chloramphenicol and cultured in the biochemical incubator. Remember, when you are working on a strain experiment, be sure to work on the clean bench.
After the bacterium proliferated well in 16 hours, selected uniform size, single strain colonies with pipette tips and put it into centrifugal tubes which contained LB medium. Cultured the cells at 37 Celsius for 30 minutes in the Shaker. Then, took 1ul of each colony from centrifugal tubes and set PCR reaction on ice. We chose VR and VF2 as primers. PCR amplifier could amplify the DNA fragment. When it finished, detected the molecular weight by DNA gel electrophoresis. The experimental results are correct DNA molecular weight. Subsequently, selected single strain colony with high concentration and transferred them to centrifugal tubes. Supplemented the tubes with the LB medium and put it into the shaking bed to make the bacteria proliferate.
Added 8 ml Escherichia coli bacterial cultural medium (contained laccase) to new centrifugal tubes. Then, added 40ul 1mol/L m-phenylenediamine to centrifugal tubes and put them into the shaker to make the bacteria proliferate. Repeated this procedure several times. In the end, transferred the culture solution of E. coli (which contained laccase) to small bottles of the liquid analyzer with pipette guns, and detected its content of m-phenylenediamine by HPLC (High Performance Liquid Chromatography). By analyzing the chromatograms of the content of MPDA, and the optical density of the cells, we suddenly could get to know whether Laccase can degrade MDPA or not
The experiment is based on artificial selection. We provide the bacteria with specific environment, culture medium with m-phenylenediamine, to select the bacteria that can decompose or consume m-phenylenediamine for energy or carbon and nitrogen. With the high percent of mutation and the original ability to decompose aniline, the bacteria are the best choice for the evolutional material.
(2)Transformation of Plasmid DNA.
Material: Plasmid (pSB1C3-bpul)
1. Take out E. coli competent cell (MG1655, DH10B, BL21(DE3)) from the refrigerator.
2. Put the plasmid on ice and put it in a constant temperature water bath (42 Celsius) for 90 s
3. Use the needle tip to take a small amount of plasmid, add it to the tube with 300 μL medium, and put it onto the plate with solid media.
(3)Protein Electrophoresis
Material: pSB1K3-LacZ, pSB1K3-GFP, pSB1K3-RBS-A-GFP, pSB1K3-RBS-B-GFP, pSB1K3-RBS-D-GFP, MG1655 bpul, DH10B bpul, BL21(DE3) bpul, loading solution (6 μL), deionized water (1000 μL), marker solution, Coomassie brilliant blue dye..
Note: pSB1K3-LacZ, pSB1K3-GFP, pSB1K3-RBS-A-GFP, pSB1K3-RBS-B-GFP, pSB1K3-RBS-D-GFP are used for collaboration with the team Shanghai_HS_United, and these plasmids were expression in strain E. coli DH10B.
1.Add 24 μL pSB1K3-LacZ, pSB1K3-GFP, pSB1K3-RBS-A-GFP, pSB1K3-RBS-B-GFP, pSB1K3-RBS-D-GFP, MG1655 bpul, DH10B bpul, BL21(DE3) bpul to 1.5mL tube respectively, and then add 6 μL loading.
2.Add 500 μL deionized water and centrifuge the tubes respectively.
3.Add another 500 μL deionized water, blow and suspend the solution.
4.Put the tubes 99℃ water for 15 minutes.
5.After heating, centrifuge the tubes for 5min.
6.Take and install the gel, add the electrophoresis buffer to the sample hole, and check if there is any leakage. Add marker, to the first and last sample holes, add pSB1K3-LacZ,pSB1K3-GFP and pSB1K3-RBS-A-GFP, pSB1K3-RBS-B-GFP, pSB1K3-RBS-D-GFP, MG1655 bpul, DH10B bpul, BL21(DE3) bpul to the other sample holes, respectively.
7.Connect the electrophoresis device to the power supply. Connect the positive electrode to the tank and the negative electrode to the slot for electrophoresis. The voltage is adjusted to 160V.
8.Turn off the power supply and disconnect the electrode until the bromophenol blue reaches the bottom of the release adhesive. Remove the glass sheet from the electrophoresis device and then remove the gel.
9.Soak the gel in Coomassie brilliant blue dye and dye it in a horizontal shaking bed for 15 min.
10. Observe the protei
(4)HPLC
Six colonies were picked, six from top to bottom, six colonies were added with 5000 um of m-phenylenediamine, and the left side was a spectrum with nothing added. The middle was added with m-phenylenediamine for one day, and the right was After adding m-phenylenediamine for three days, the content of S-1 and T-5 was found to decrease when the content was detected.
(5)Tests of bpul degrade m-Phenylenediamine
The three laccase expression strains MG1655, BL21(DE3), and DH10B (with pSB1C3-bpul) were incubate with m-Phenylenediamine (0.33 M). Place the solutions into the shaker. It is observed that the colors of the solutions become dimmer, indicating that the degradation has been successful.
Culture
Material: LB medium (2mL), pSB1K3-RBS-A-GFP, pSB1K3-RBS-B-GFP, pSB1K3-RBS-D-GFP, pSB1K3-GFP, pSB1K3-FnCas12a, pSB1K3-LacZ, pSB1K3-J23100-B0034-ter
1.Take several test tubes and add to 2mL KAN medium respectively.
2.Take the cultured pSB1K3-RBS-A-GFP, pSB1K3-RBS-B-GFP, pSB1K3-RBS-D-GFP, pSB1K3-GFP, pSB1K3-Facas12a, pSB1K3-LacZ, pSB1K3-J23100-B0034-ter, use the needle tip to take a small amount, and put it onto the shaking table.
3.Measure the Fluorescence value and the OD value before and after centrifugation.
DNA gel electrophoresis
A. Material: TBE (100ml), DNA loading buffer (10μL), agarose (1g), Nucleic acid dye PCR product (5μL for each)
1. Add 100ml TBE and 1g agarose to a triangular flask put them into microwave oven till all agarose melt.
2. Cooldown the solution, then add Nucleic acid dye and add the solution to the device, and wait for solidification.
3. After solidification put the running gel into the electrophoresis device and add TBE.
4. Add 1μL loading buffer into each PCR product, then add 5μL of each mixture into the hole.
5. Begin electrophoresis.
6. Take out the gel then put it under UV light
3.Idetification of bacteria from aniline-polluted sludge
Microorganisms with p-toluidine and m-toluidine as the only carbon source have grown on the plate, but the species name is unknown. We perform PCR with the following primers:
16s-27F: AGAGTTTGATCCTGGCTCAG
16s-1429R: GGTTACCTTGTTACGACTT
The PCR products were then sent to the sequencing company for sequencing, and the results were analyzed by BLAST as follows: the specie on the 100% identities is Bacillus aryabhattai B8W22
4.We constructed the secretion of proteins by constructing signal peptides plasmid (GFP). (Collaboration with Shanghai_City)
Measure the fluorescence secretion of E. coli
Experiment steps: 1. 20 bacteria culture 20ul were absorbed and put into the microtitration plate. 2. Centrifuge the remaining bacteria solution at 12000g for 1 min 3. Draw 20ul of supernatant from 20 bottles after centrifugation and put it into the microtitration plate. 4. Put the plate into the instrument to measure the absorbance and fluorescence.
Results:1.pelB-GFP,2.ompA-GFP,3.stII-GFP,4.phoA-GFP,5.OmpF-GFP,6.phoE-GFP,7.ompC-GFP,8.LPP-GFP, 9.ompT-GFP, 10.LTB-GFP as the 1-10 in the following table. A and B were suspensions, G and H were supernatants.
As can be seen from the table, the absorbance of the bacterial solution is generally higher than that of the supernatant, while the fluorescence measurement shows that the value of the supernatant is relatively small, generally 30-40, compared with the value of about 1000 of the bacterial solution.
Conclusion: the low fluorescence of supernatant indicates that E. coli can only secrete a small amount of fluorescent substances to the extracellular environment.Since there is no control group, it is difficult to confirm the specific amount of fluorescent substances secreted. Solution: add pure water or non-fluorescent bacteria into the microtitration plate to measure the fluorescence degree, and confirm the difference between the fluorescence components and them in the supernatant.
Next Day
Experimental steps:
1. Take out the E. coli cultured in a shaker yesterday (6 in total) and divide them into three groups: no GFP gene, GFP gene without signal peptide and GFP gene with signal peptide. Proper amount of bacterial suspensions and supernatant samples after centrifugation were successively extracted for absorbance detection.
2. Extract appropriate amount of bacteria solution: extract 200 microliters of bacteria solution from each tube and put it into group A 1-6 Wells of 96-well plate
3. Supernatant extraction: again, extract 500 microliters of bacterial liquid from each tube, place them in the labeled EP tube, and put them into a centrifuge for centrifugation. After centrifugation, 200 microliters of supernatant were extracted from each tube and put into group B Wells 1-6 of the 96-well plate.
4. Put the 96-well plates into the microplate reader and test their absorbance.
Experimental results:
The first two are controls, 3,4 for GFP, and 5,6 for LPP-GFP
Conclusion: In suspension, GFP containing E. coli have high value of fluorescence, while adding signal peptide has a little effect. So the signal peptide can improve the absorbance a little.