Team:Xiamen City/Demonstrate
Plasmid Construction (the detail information please see parts)
We constructed the bpul expression E. coli for m-phenylenediamine degradation.
Fig 1. The map of plasmid pSB1C3-J23100-RBS-bpul-ter.
We constructed and measured the expression of GFP in the construction of type IIS. (Collaboration with Shanghai_HS_United)
Fig 2. The map of plasmid pSB1K3-J23100-B0034-GFP-ter-typeIIS-RBS-A.
We constructed the secretion of proteins by constructing signal peptides plasmid (GFP).
Fig 3. The map of plasmid pSB1K3-J23100-PelB-ter.
Protein expression
Fig 4. Expression protein and run gel electrophoresis using plasmid containing E.
coli. pSB1K3-LacZ, pSB1K3-GFP, pSB1K3-RBS-A-GFP, pSB1K3-RBS-B-GFP, pSB1K3-RBS-D-GFP, MG1655 bpul, DH10B bpul, BL21(DE3) bpul. Note: pSB1K3-LacZ, pSB1K3-GFP, pSB1K3-RBS-A-GFP, pSB1K3-RBS-B-GFP, pSB1K3-RBS-D-GFP are used for collaboration with the team Shanghai_HS_United, and these plasmids were expression in strain E. coli DH10B.
Adaptive evolution of E. coli expressing laccase
Fig 5. Six colonies were picked, six from top to bottom, six colonies were added with 5000 um of m-phenylenediamine, and the left side was a spectrum with nothing added. The middle was added with m-phenylenediamine for one day, and the right was After adding m-phenylenediamine for three days, the content of S-1 and T-5 was found to decrease when the content was detected.
Fig 6. The three laccase expression strains MG1655, BL21(DE3), and DH10B (with pSB1C3-bpul) were incubate with m-Phenylenediamine (0.33 M). Place the solutions into the shaker. It is observed that the colors of the solutions become dimmer, indicating that the degradation has been successful.
GFP meansurement of RBS strength
Methods:
1.20 bacteria culture 20 ul were absorbed and put into the microtitration plate.
2.Entrifuge the remaining bacteria solution at 12000g for 1 min.
3.Draw 20ul of supernatant from 20 bottles after centrifugation and put it into the microtitration plate.
4.Put the plate into the instrument to measure the absorbance and fluorescence.
Results:
Fig1. The concentration of microbes in suspensions and supernatants
Fig2. The fluorescence of GFP in suspensions
Fig3. The fluorescence of GFP in supernatants
As can be seen from Fig1, the absorbance of the bacterial solution is generally higher than that of the supernatant, while the fluorescence measurement shows that the value of the supernatant is relatively small, generally 30-40, compared with the value of about 1000 of the bacterial solution(Fig2 and Fig3). The fluorescence of pelB-GFP was higher than the control. It turned out that the protein pelB-GFP was expressed successfully and secreted to the extracellular environment.
the low fluorescence of supernatant indicates that E. coli can only secrete a small amount of fluorescent substances to the extracellular environment. And liken to the control group, it is easy to confirm the specific amount of fluorescent substances secreted.
Next Day
Methods:
1. Take out the E. coli cultured in a shaker yesterday (6 in total) and divide them into three groups: no GFP gene, GFP gene without signal peptide and GFP gene with signal peptide. Proper amount of bacterial suspensions and supernatant samples after centrifugation were successively extracted for absorbance detection.
2. Extract appropriate amount of bacteria solution: extract 200 microliters of bacteria solution from each tube and put it into group A 1-6 Wells of 96-well plate
3. Supernatant extraction: again, extract 500 microliters of bacterial liquid from each tube, place them in the labeled EP tube, and put them into a centrifuge for centrifugation. After centrifugation, 200 microliters of supernatant were extracted from each tube and put into group B Wells 1-6 of the 96-well plate.
4. Put the 96-well plates into the microplate reader and test their absorbance.
Results:
Fig4. The fluorescence of GFP in suspensions and supernatants
In suspension, GFP containing E. coli have high value of fluorescence, while adding signal peptide has a little effect. So the signal peptide can improve the absorbance a little.
Idetification of bacteria from aniline-polluted sludge
Microorganisms with p-toluidine and m-toluidine as the only carbon source have grown on the plate, but the species name is unknown. We perform PCR with the following primers:
16s-27F: AGAGTTTGATCCTGGCTCAG
16s-1429R: GGTTACCTTGTTACGACTT
The PCR products were then sent to the sequencing company for sequencing, and the results were analyzed by BLAST as follows: the specie on the 100% identities is Bacillus aryabhattai B8W22
Discussion and Future plan
1.Adaptive evolution with MG1655 had not resulted in the mutation of degradable m-phenylenediamine. Conditions may need to be changed and adaptive evolution should be extended.
2.The laccase protein expressed bpul gene is preliminarily proved to be degradable m-phenylenediamine, but what it is transformed into needs to be explored and whether it can be adapted to evolve microorganisms with m-phenylenediamine as the only carbon source.
3.Bacteria from aniline-polluted sludge which can use p-toluidine and m-toluidine as only carbon source is Bacillus aryabhattai B8W22. Next, we want to perform adaptive evolution that this bacteria use m-phenylenediamine as its sole carbon source.