Team:Nanjing/Experiments

a. Centrifuge the collection tube with plasmid powder for 1 minutes under 500rpm to descend the powder to the bottom. Add 20μl sterile water to dissolve the plasmids, and rest it on the lab table for 1min under room temperature;

b. Take the competent cell (DH5α E.coli) from the fridge (-80℃ storage condition) and place on the ice box for melting. During the time, mark the tube that will be used to put competent cells;

c. Take 2μl plasmid solution using pipette and add it into 2μL competent cells. Leave the ice-bath for 30 minutes. At the same time, heat the water-bath so we can save time;

d. Take out the tube from the ice-bath, and let the solution undergoes heat shock for 90 seconds under the temperature of 42℃. Leave it into ice-bath again for 2 minutes;

e. Add 500μL LB liquid culture medium without antibiotics into the solution. Put it on the shaker for 45 minutes at 180rpm to promote cell replication;

f. Centrifuge the solution for 5 minutes under 6000rpm and pour it to culture dish with LB solid medium (containing Kanamycin this time). Use the glass rod to distribute bacteria evenly across the medium surface and let it dry;

g. Leave the culture dish upside down and cultivate bacteria for 12 to 16 hours; Pick the single colony and put it into liquid LB culture medium with Kanamycin. Cultivate bacteria on the shaker for 12 to 16 hours, and we can then extract the plasmid we need accordingly.

2. PCR：

Forward：ATGAGCTTTCTTCAGGCCTTG

Reverse：CTACATTGAGTCCACCGAGA

PCR system（50 µL system）

ddH2O 14 µL

Phanta Max Buffer (2×) 25 µL

ddNTP Mix (10mM each) 1μL

UP 2 µL

DN 2 µL

c DNA (GOI) 1 µL

PCR procedure

Step1 95 ℃ 3min

Step2 95 ℃ 15 s

Step3 56 ℃ 3 min

Step4 Go to 2 for additional 35 cycles

Step5 72 ℃ 10 min

Step6 4 ℃ end

3. Recycle the PCR product using PCR recycle kit (provided by Beyotime)

4. PCR (add the proper restriction sites)：

Forward：GAATTCATGAGCTTTCTTCAGGC （EcoR I）

Reverse：AAGCTTCTACATTGAGTCCACCG (Hind III)

PCR system（50 µL system）

ddH2O 14 µL

Phanta Max Buffer (2×) 25 µL

UP 2 µL

DN 2 µL

c DNA 1 µL

PCR procedure

Step1 95 ℃ 3min

Step2 95 ℃ 15 s

Step3 56 ℃ 3 min

Step4 Go to 2 for additional 35 cycles

Step5 72 ℃ 10 min

Step6 4 ℃ end

5. Extract plasmid from Plasmid Extraction Kit (provided by TAKARA)

EcoRI

Hindlll

6. Use restriction enzyme to but open the plasmids and the GOI

a. The restriction enzymes we use were EcoR I and Hind III (provided by TAKARA). The reaction system is shown below:

ddH2O 16 µL

plasmid DNA 1 µL

10×K buffer 1 µL

EcoR I 1 µL

Hind III 1 µL

Total volume 20 µL

Add all these materials according to the above sequence into sterile PCR tube. Mix them and centrifuge the solution for several seconds until no bubbles exist. Keep the temperature at 37℃ for 3.5 hours to react.

7. Perform an electrophoresis to separate gene fragments.

a. Prepare agarose gel with dilute TAE (0.1%);

b. Add fluorescence marker into the agarose gel and leave the liquid gel under room temperature for 30 minutes to let it solidify;

c. Add gene fragments and plasmids into the groove, immerse the gel with dilute TAE (0.1%);

d. Put the gel in the correct direction (grooves at the positive pole). Connect to electricity and leave the gel for 1 hour;

e. Turn off the power and view the gel under UV light.

8. Recycle the product after electrophoresis

a. Cut open the gel under the UV light and put the gel bar containing gene fragments into centrifuge tubes;

b. Recycle the gene fragments using Gel Recycle kit for large DNA chains (provided by TAKARA);

9. DNA ligation

a. The ligation system is shown below (10 µL system):

GOI 4 µL

pCAMBIA 2301 cloning vector 0.5 µL

T4 DNA ligase (provided by TAKARA) 0.5 µL

10×T4 DNA ligase buffer 1 µL

ddH2O 4 µL

keep the system under 16℃ for 3 hours to combine.

10. Transform ligation product into E.coli competent cells (DH5α) to amplify the plasmid

a. Take 10μl ligation product solution using pipette and add it into 2μL competent cells. Leave the ice-bath for 30 minutes. At the same time, heat the water-bath so we can save time;

b. Take out the tube from the ice-bath, and let the solution undergoes heat shock for 90 minutes under the temperature of 42℃. Leave it into ice-bath again for 2 minutes;

c. Add 1000μL LB liquid culture medium without antibiotics into the solution. Put it on the shaker for 45 minutes at 180rpm to promote cell replication;

d. Centrifuge the solution for 5 minutes under 6000rpm and pour it to culture dish with LB solid medium (containing Kanamycin this time). Use the glass rod to distribute bacteria evenly across the medium surface and let it dry;

e. Leave the culture dish upside down and cultivate bacteria for 12 to 16 hours;

f. Pick the single colony and put it into liquid LB culture medium with Kanamycin. Cultivate bacteria on the shaker for 12 to 16 hours

11. Extract plasmids using plasmid Extraction Kit (provided by TAKARA)

12. Transform the plasmids into Agrobacteria tumefacien (GV3101) electroporation competent cells (provided by Mitose)

a. Take out the competent cells from fridge (storage condition: -80℃) and place it on the ice box for melting;

b. Add 1μL plasmids into the competent cells, mix them and put the final solution into electroporation cuvette (20mm);

c. Impulses for 5ms;

d. Quickly add 1mL liquid LB cultivation medium and mix them;

e. Put the solution into EP tube under room temperature;

f. Add 70-80μL agrobacteria solution evenly onto LB solid medium containing antibiotics (Kan);

g. Use the glass rod to make the solution dry and turn the dish upside down to cultivate for 2 days (under 28 ℃);