Team:Nanjing/Contribution


Characterization or Contribution

Standard:

We adapted the part to be able to assemble our gene of interest (BBa_K3253003) with the cloning vector (BBa_K3253005) to test whether our gene of interest has already been successfully transferred to the Agrobacterium and our target plant. This florescent gene was expected to have its greatest excitement wavelength at 510nm, which is an indicator of the result of our transfer.

Due the delay of the gene posting from the IGEM official for a month. The official promised that the gene would arrive at 10th August, but the actual Ghchi6 sequence arrived at China at 7th September. This is the main reason that we haven't finished our experiment on time. Please take this into consideration. We have shown our progress in our demonstration.

Special:

We used the gene Ghchi6, a new part which has never used previously in IGEM, to enhance tobacco’s aphid resistance. Also the plasmid pCAMBIA2301 to take the Ghchi6 gene in order to propagate the plasmid in the E.coli and then transfer the plasmids to the agrobacteria to infect and transfer our gene of interest to plants.

This gene is found in red chicken-feet cotton, and it belongs to Glyco-hydro-19's subfamily. This gene is composed of 975 bases and codes for the synthesis of class I chitinase which is made up of 324 amino acids. When the cotton is physically attacked by aphids, the gene Ghchi6 gets overexpressed that the plant starts to secrete chitinase. The overexpression of Ghchi6 can improve the aphid-resistance in cotton, and we plan to transfer this favored gene to tobacco to improve its aphid-resistance. Through modifications we have transferred the gene to Agrobacterium and then to the tobacco through infection. Normally the expression of chitinase in plants is very low under common conditions, but in cottons the expression is triggered by external factors like mechanical damage.

Ghchi6 gene was cloned from red-chicken-feet-leaf cotton, it consists of 975 bps, encoded a protein of 324 amino acids, and belongs to Glyco-hydro-19 subfamily, as the class I kind chitin. Its molecular weight is 34.65 k Da and isoelectric point is 7.81. Through amino acid sequence comparison, cotton gene Ghchi6 and other plant chitinase genes are highly conservative, and is evolutionarily close relative to chitin of woody cotton. After Aphis gossypii attack, the expression level of Ghchi6 was suppressed in cotton leaves and stems. However, its expression level was up-regulated in the mechanical wounded cotton leaves, which suggested that Ghchi6 expression level was relative to the induction from cotton aphids or mechanical wounding. The code is shown below:

5’>ATGAGCTTTCTTCAGGCCTTGTCAGTTTTCCTTTTGTTTTTGTCGTATGTAG

TCGTAGGATCAGCTGAGCAGTGTGGAAGGCAAGCAGGTGGTGCTCTTTGCCC

CGGTGGTCTATGTTGTAGCCAATTTGGCTGGTGTGGCAGTACTGCTGACTACT

GCACAGTTCCTGGTTGCCAAAGTCAGTGCAGCGGTAGTGGCCCTGCCCCTGG

GCCTGGTGGGCTAACCAATCTTATATCAAGAGAGACGTTTAATCGGATGCTTT

TGCATAGGAACGATGGGGCTTGTCCTGCCCGTGGCTTCTATACATATGATGCT

TTCATTGCTGCTGCCCGTTCCTTTCCTGCATTTGCTACAACTGGTGACCAAGC

TACTCGCAAGAGGGAAATAGCTGCCTTCTTAGCCCAAACTTCCCATGAAACT

ACTGGTGGGGCAGGGTGGGCTGCACCGGATGGTCCTTATGCATGGGGATACT

GCTACAATAGGGAATTGAATCCCCCTTCATCTTACTGCGCTTCCGGTCCAAAT

TACCCTTGTTCTCCTGGTAAACAATATTTTGGCCGGGGTCCCATGCAACTTTC

TTGGAACTACAACTACGGGCCGTGTGGAAGGGCCATAGGGGTGGACTTGTTA

AACAACCCAGACCTGCTATCAAGTGATCCCACAGTTTCCTTCAAGTCTGCGT

TTTGGTTTTGGATGACTCCACAATCACCGAAGCCATCTTGCCACAATGTGATC

ATCGGAGCATGGTCACCCTCTAGTAGCGATCGCGCAGCAGGTCGGGCTACAG

GGTATGGTGTGATCACAAATATTATCAATGGAGGCCTTGAATGTGGTAAGGGT

TGGAATGCACAGGTAGAAGACCGCATTGGGTTCTATAAGAGGTATTGTGACA

TTCTTGGAGTTAGCTATGGTAACAATCTTGACTGCTACAACCAGAGGCCTTTC

GGGAATGGAGTCTCGGTGGACTCAATGTAG<3’