Team:GZHS-United/Experiments
A. Experiment
1. Selection of research objects
According to mechanism part, peroxide is one of the direct signal molecule clusters which cause coral bleaching, and ascorbic acid peroxidase (APX) is the most effective enzyme in peroxide degradation. By researching and analyzing various zooxanthella APX clades, we chose SymAPX3 as the research object, and download sequence information in the KEGG website.
By reading the scientific essays, we found that arabidopsis, as a higher plant, can withstand much more severe stress conditions such as high temperature, strong illumination and extreme pH stress than zooxanthellae. Therefore, we hypothesized that the APX enzyme of higher plant(arabidopsis) can also withstand high temperature, strong illumination and extreme pH stress than zooxanthellae and overexpression of higher plant APX gene in algae could solve the problem of inactivation and loss of algal APX under high temperature conditions. We also designed the in vitro expression and enzyme activity measurement of arabidopsis APX.
We compared the sequence, predicted function and mark the part with high similarity and conservatism in the sequence in functional sites such as heme binding site and H2O2 binding site which are mentioned in the scientific report. We took H2O2 binding site as the entry point, designing and doing experiment in vitro expression, measure the enzyme activity, and verified the prediction of this site on the level of biological experiment.
2.1 APX gene acquisition of arabidopsis thaliana
We extracted the whole mRNA genome of arabidopsis using Trizol measure by kit. Then, the arabidopsis cDNA was obtained by rt-pcr. The gene fragment was amplified by PCR and connected to pet28b-rplJ to obtain the ATAPX1 connected to pET28b-rplJ.
2.2 APX gene acquisition of zooxanthella
To verify the H2O2 binding site, we designed to measure and compare the enzyme activity of wild type and mutant enzyme proteins by mutating this site. If the enzyme activity data conform to the prediction (the activity difference is large), it indicates that the H2O2 binding site predicted in the text is accurate and can be used for further research, such as structural optimization.
The article pointed out that amino acid RL was conserved amino acid, so we chose the first case where mutating RL to AA. At the same time, it was pointed out that the H2O2 binding site had 7 amino acids (RLSWHDA), so the second case we chose was to mutate all the charged amino acids (R, H, D) to alanine (A), and the nucleotide sequence was mutated from "cggttgtcctggcatgatgca" to "gcgttgtcctgggccgcggca". Then, we connected these sequences into plasmid pET28b
After modifying the sequence, we sent the sequence information to the biological company for synthesis, and obtained SymAPX3, SymAPX-mut1 and SymAPX-mut2 genes which respectively connected to plasmid pET28b.
3. Expression of prokaryotic protein and his-tag protein purification
The recombinant plasmid was transferred into DH5a for amplification. After doing plasmid extraction, it transferred into BL21 strain to do prokaryotic protein expression. The cell efflux was obtained after ultrasonically broken bacteria solution and the protein purification was performed. (see Protocols on the Experiments page for details)
4. Determination of ascorbate peroxidase activity
After obtaining the purified protein solution, AsA oxidation rate was measured by using APX activity detection kit. By putting it into the enzyme activity calculation formula, we gain the results.
B. Protocol
C. Development of Project
1) Decide the topic of research project and read scientific essays
2)Amplified the cDNA from arabidopsis thaliana to get the target sequence (ATAPX1) . Select the target sequence (SymAPX3) and give it to the biological company for synthesis to transfer into the plasmids(SymAPX3-mut1&SymAPX3-mut2) after mutation.
3) Prokaryotic protein expression and His-tag protein purification
4) Measurement of ascorbate peroxidase activity