Team:UCAS-China/People/Notebook

Notebook

Notebook can be downloaded here

Protocols

Preparation of competent cells

1. Streak competent cells on LB plates, and incubate overnight.

2. Pick a single colony and incubate at 37°C in 4ml LB medium.

3. Add 100l of bacteria solution to 100ml LB medium in conical flask.

4. Shake the flask at 37 °C until the OD600 reaches 0.4-0.5, about 3h.

5. Place the conical flask quickly on ice, violently oscillate it to cool it down quickly.

6. Transfer the medium to a pre-cooled centrifuge tube, centrifuge at 4500 rpm for 10 min, and discard the supernatant.

7. Add 2/3 volume of pre-cooled CaCl2-MgCl2 mixture to each tube, resuspend the cells, and ice bath for 10 min.

8. 4 degrees, centrifuge at 4500rpm for 10min, completely discard the supernatant

9. Add 1/25 volume of pre-cooled 0.1M CaCl2 solution to each tube, resuspend the cells, and ice bath for 10 min.

10. Add 7% volume of pre-cooled DMSO to each tube, ice bath for 10 min, dispense into 1.5 ml EP tube, dispense 100 per EP tube, and store in -80 refrigerator.

Bacteria strain preservation

1. Mix 900 bacteria solution with 900 glycerin (60%)

2. Store the mixture in a -80 degree refrigerator

Chemical transformation

Material:

Plasmid solution to be transformed

Competent DH5α cells

LB broth

Selection plates

Ice

1.5mL Microtubes

Methods:

1.Pipette 50µl of competent cells into pre-chilled 1.5ml tube: 50µl in a 1.5ml tube per transformation. Tubes should be labeled and pre-chilled. Keep all tubes on ice.

2.Pipette 4µl of resuspended DNA into 1.5ml tube: Gently pipette up and down a few times. Keep all tubes on ice.

3.Close 1.5ml tubes, incubate on ice for 30min.

4.Heat shock tubes at 42°C for 90 sec: 1.5ml tubes should be in a floating foam tube rack. Place in water bath to ensure the bottoms of the tubes are submerged. Timing is critical.

5.Incubate on ice for 3 min: Return transformation tubes to ice bucket.

6.Pipette 700µl LB media to each transformation.

7.Incubate at 37°C for 1 hours, shaking at 220 rpm

8.Spin down cells at 4000 rpm for 2mins and discard 550µL of the supernatant. Resuspend the cells in the remaining 200µL, and pipette each transformation onto selection plates with appropriate antibiotics. Spread with sterilized spreader or glass beads immediately.

9.Incubate transformations overnight (14-18hr) at 37°C: Incubate the plates upside down (agar side up).

10.Pick single colonies: Pick single colonies from transformations: do a colony PCR to determine whether the transformation is successful.

Colony PCR

Material:

Sterile Water

Selective LB broth

12.5 µL 2*SuperfastTaq mastermix

1 E. coli colony

1 µL of 10 µM forward primer

1 µL of 10 µM reverse primer

Methods:

1.Pick single colonies and incubate 150 µL LB broth in a 96-well plate.

2.Incubate 2 hours at 37°C, 1000rpm.

3.Combine 0.5 µL cell culture, 12.5 µL 2*SuperfastTaq mastermix, 1 µL of 10 µM forward primer, 1 µL of 10 µM reverse primer, and sterile water up to 25 µL.

4.Incubate in the thermocycler, the settings are as follows.

PCR from template

Material:

5x FastPfu buffer

10 µM forward primer

10 µM reverse primer

PCR tube

Sterile water

Template DNA

Methods:

1. In a PCR tube, combine 1 µL of plasmid DNA, 2 µL of 10 µM forward primer, 2 µL of 10 µM reverse primer, 10 µL of 5x FastPfu buffer, 1.5 µL of 10 mM dNTP mix, 0.5 µL of FastPfu and sterile water up to 50 µL.

2. Gently mix the reaction

3. If necessary, collect the liquid to the bottom of the PCR tube by spinning briefly

4. Transfer the PCR tube from ice to a PCR machine preheated to 98°C to begin thermocycling The settings are as follows.

DNA gel electrophoresis

Material:

Agarose Powder

TAE buffer

Gel mould

GoldView

Gel Tank

DNA ladder

DNA loading dye

Methods:

1.Prepare 1% w/v solution of agarose powder in 1x TAE buffer using a conical flask

2.Heat the mixture until agarose is completely dissolved.

3. Add 0.01% GoldView to the solution. Make sure there are no bubbles in the solution.

4. Pour the solution into a gel mould

5.Allows the solution to set (approx 15-20 minutes)

6.Transfer the agarose gel to a tank, remove the comb and apply:

4 µL of the DNA ladder

4 µL of DNA samples with the corresponding amount of DNA loading dye (6X)

7.Run the gel for 14 minutes at 160V

Gibson Assembly

Material:

2x Hieff Clone MultiS Enzyme Premix

Linear DNA to be Assembled

Sterile water

Methods:

1. Combine 10 µL of 2x Hieff Clone MultiS Enzyme Premix, 30-50 ng of linear backbone vector, linear DNA fragments(nf/ nv=5:1) and sterile water up to 20 µL

2.Incubate for 1 hour at 50℃.

Protein Purification

Material:

Erlenmeyer

Bacterial fluid

Centrifuge tube

Ultrafiltration tube

Methods:

Broken cell

1) Dispense the bacterial liquid in the Erlenmeyer flask into a 50ml EP tube, centrifuge, 3000r/30min, 4°C

2) Resuspend the pellet in all 50ml tubes using lysis buffer, and finally make a total volume of 4ml and transfer to a small beaker.

3) Wash the above 50 ml tube with 1 ml of lysis buffer, collect the washing solution into a small beaker, and place it on ice.

4) Ultrasonic lysis for 20min

5) Dispense the lysate into a 1.5ml tube and centrifuge, 12000r/35min, 4°C

Through the pillar

1) Wash the column with the elution buffer, then wash the column with water

2) Add the supernatant of the lysate to the column, cover the upper and lower ends of the column, and place on the ice shaker for 1h.

After the incubation is completed, open the upper and lower lids to allow the liquid in the column to drain. You can use the ear wash ball.

3) Washed off the protein: washed twice with lysis buffer (20 mM imidazole), then washed 5-6 times with a solution containing 50 mM imidazole (obtained by mixing 20 mM imidazole with 500 mM imidazole in a ratio of 15:1), using 15 ml EP tube Collect the last wash solution 5-6ml, and use the 1.5ml tube to collect 1ml for the protein gelatin (if the band of the target protein is washed, it means it has been washed); then wash it once with 500mM imidazole and collect it into the ultrafiltration tube. , (for subsequent protein gelatin, see if the target protein also contains heteroprotein)

4) Centrifugal concentration: The ultrafiltration tube is firstly leveled, then centrifuged for concentration, 3700r/1h, 4°C, centrifuged for 1h, then the lower layer of the ultrafiltration tube is drained, re-watered, leveled, centrifuged again, 3700r/1h, 4°C ( The longer the time, the better)

Protein glue

1) Put the double glazing into the glue tank

2) Prepare the SDS-PAGE lower layer liquid and add it into the double-layer glass tank. Add about 3.3ml (can not be filled) (※ this step should be fast, otherwise it will be easy to coagulate)

3) Configure the concentrate and add it to the double-layer glass tank. Add about 1.5ml (add it to the lower layer of liquid and fill it to the edge of the double-glazed glass).

*ap (ammonium persulfate, generally used 10%, can be used now) and is an enzymatic agent, must be added at the end

Insert comb

Flow Cytometry

Material:

Resistant lb

IPTG

Bacteria

96-well plates

Methods:

1. Pick 3 single colonies/group, 150 μL/well in a 96-well plate for 8-12 h.

2. Gradient induction: 0-1m/l 10 times concentration gradient per well + 100 times dilution of bacterial solution.

2.1Formulate 1mol/L IPTG-LB (with resistance).

2.2 Add 148.5 μL LB (with resistance) to well 1-7 and 165 μL of 1 mol/L IPTG-LB (with resistance) to 8 wells.

2.3 16.5 μL from 8 wells was added to 7 wells, 16.5 μL from 7 wells was added to 6 wells...16.5 μL from 1 well was discarded.

2.4 Add 1.5 μL of bacterial solution to each well.

2.5 The above 20 groups are similar, and a total of 5 96-well plates are required.

3. Shock culture overnight.

4. Dilute by 1×PBS with kanamycin to 50 to 100 times.

5. Test by FCM.

HPLC

Material:

Mobile phase

Column

sample

Methods:

1. Collect samples on time according to your needs, samples need to be collected in special bottles;

2. After the sample is collected, turn on the test instrument;

3. Exhaust the experimental instrument, which takes about 2~3 minutes;

4. When the column is not added, pass the instrument through the desired mobile phase (for example, pump+func (0.5mL)), which takes about 10~20 minutes;

5. Turn off the pump, connect the desired column to the instrument, and repeat step four.

* Remember to check if the direction of the column is correct

6. Place the sample in the specified location

7. Connect the computer, confirm the setting conditions, and batch process the samples.

*You can try one of them before batch processing.

Temperature response curve

Material:

Plasmid for the corresponding element

96-well plate

Deep well plate (prepared tin foil paper in advance, sterilized deep-well plate)

Methods:

1. Transform the plasmid of the corresponding element and grow for 8-12h.

2. Pick the monoclonals and incubate them in a 96-well plate for about 12 hours (each group picks at least 3 monoclonals as 3 parallel groups; note that the position added in the 96-well plate must be marked in advance)

3. Transfer the bacterial solution from the 96-well plate to the deep well plate and add LB (add the corresponding antibiotic) at a ratio of 1:1000 (take 0.8 μl of the bacterial solution and add 79.2 liters of LB to make the total volume of 800 Dilute) and then incubate for 20 h in an incubator at different temperatures (so that the bacteria at different temperatures have grown to the plateau)

4. After the culture is completed, pipette 200 μl of the bacterial solution into a new 96-well plate and dilute 10 times and 100 times.

5. Determine the od value and fluorescence value by using a microplate reader, and observe whether the green fluorescence is directly observed under the blue light.

Escape rate

1. Pick a single colony/absorbed preserved bacterial, add 5mL of resistant LB medium in a 15mL centrifuge tube, and incubate in a shaker at 37 °C until the late logarithmic growth phase (culture time 10~12h, OD600~1.0-1.2）

2. In the ultra-clean platform, absorb the liquid in the centrifuge tube into the same 2mL centrifuge tube in several times. Out the ultra-clean platform, centrifuge and make the bacteria subside. Discard the supernatant in the ultra-clean platform and washed with 1×PBS for two times (add 1 × PBS, blow + resuspend, and then centrifuge to discard the supernatant), resuspend with 200 μL of 1 × PBS

3. Use a 96-well plate for 10x serial dilutions until 10^(-8) or less

4. Take 10uL points of different diluted samples on each plate (with resistance), arrange them neatly, set the spacing (can be measured in advance and mark the position on the back of the culture dish / printed on white paper), just as the follow picture:

5. Place the plate at 25 ° C, 37 ° C for 12, 24 hours (to grow a countable single colony, be careful not to overgrow)

6. After taking the corresponding time, take photos and count the number of colonies that grow (take the maximum dilution factor on which the colonies is countable for counter sample), calculate the escape rate:

7. Calculate Escape Frequeny for each panel in each group, then calculate the average escape rate and standard difference.

Gene Knock-out[2]

1.General procedure of the experiment

a. Transform plasmid A(pCas) into the host, and select with plate containing kanamycin in 30℃.

b. Select positive clone and incubate in liquid LB (contain kanamycin) and prepare competent cells for electroporation. Add arabinose to 10mM induce the expression of RED 1 hour before centrifuge the culture.

c. electroporate plasmid TargetT, which contain homologous sequence of the host, or plasmid TargetF, which does not contain homologous sequence of the host, and a piece of homologous DNA into the competent cells, incubate at 30℃ for an hour, select with plate containing kanamycin and spectinomycin.

d. After incubating at 30℃ overnight, verify whether the gene is knockout by PCR.

e. Incubate positive clone in liquid LB containing kanamycin and IPTG(5mM) for 8-20 hours, and obtain monoclonal by streak culture, verify the expulsion of plasmid B ((pTargetT or pTargetF).

f. Do b to e again to bacteria who exclude plasmid B.

g. Incubate bacteria at 37 ℃ liquid LB to exclude plasmid A.

2. The construction of pTargetT (contain homologous sequence).

(Use the knockout of cadA as example)

Figure 2 Gene module for gene knockout.

The yellow part in figure changes with the target gene, but the blue part stays the same. 2.1 Design primers for the amplification of N20-sgRNA, which contains the sgRNA sequence of target gene.

Figure3 N20-sgRNAsequence use for knockout of cadA

As seen in the figure, the primers designed are as follow:

Figure 4 The gene sequence used for knockout of cadA (shown on the genome of host)

In the sequence of primer cadAspc, the N20 sequence (red part) is supposed to be a part of sequence of target gene, and in the sequence of target gene, sequence NGG is supposed to follow N20 sequence, that is to say, there is supposed to be sequence in the from of N20+NGG, and no repetition sequence.

After obtaining the product of amplification of N20+sgRNA and overlap amplification of homologous sequence (cadA-1 and cadA-2), use spel/SalⅠ restriction enzyme to cut the homologous sequence, and insert it into pTargetF.

2.2 Tips for design of primes.

a. You can put cutting site of enzyme that has the same cohesive such as xbal and ndel in the sequence of primer cadAspc.

b. It will be convenient if cutting site of sal, pstⅠ, hindIII or bglⅡ are put in the sequence of R primer for homologous sequence.

c. It is also feasible if you connect the two pieces of homologous sequence to the vetctor(pTargetT) straightforward instead of the overlap connection first.

d. It will be convenient for GIBSON connection if you design your primer a little longer for about 20bp.

3. The construction of pTargetF (does not contain homologous sequence).

Amplify pTargetF with primer as follow:

TCCTAGGTATAATACTAGT+N20+GTTTTAGAGCTAGAAATAGC ACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAG

And digest the template with DpnI, transform the product into DH5α, sequencing toverify.

Reference:

[1] Fernandez-Rodriguez J, Moser F, Song M, et al. Engineering RGB color vision into Escherichia coli[J]. Nature Chemical Biology, 2017, 13(7):706-708.

[2] Jiang W, Bikard D, Cox D, et al. RNA-guided editing of bacterial genomes using CRISPR-Cas systems[J]. Nature Biotechnology, 2013, 31(3):233-239.