Team:TU Dresden/Characterization
Beaming BioBricks from Space...
Characterization
Outline
1) Expression of different proteins: monitoring growth2) Expression of proteins with our backbone before and after optimization
3) SDS-PAGEs for the expression assay over the time of Full Construct (BBa_K3037003)
4) Image analysis of the expression in the SDS-PAGEs with ImageJ
Experiments in Detail
To evaluate the impact on the metabolic burden of over-expressing proteins, we tested different constructs cloned into our backbone. For this we used: HRP (BBa_K3037007) and our full construct (BBa_K3037003). After cloning, the constructs were expressed in E. coli pRARE T7 and we monitored growth over time (Figure 2). Induction of the system was performed after 165 min with 1 mM IPTG. Overall, the results prove that when expressed, none of our proteins inhibit growth.
Figure 2: Growth curves of E. coli strains carrying our expression backbone with different inserts. Expression was induced after 165 min of incubation with 1 mM IPTG
To use this backbone as convenient expression vector in iGEM, we had to include the Prefix and Suffix of the BioBrick Assembly. Subsequentially, we compared the expression of the original vector we recieved, pOCC97, to our optimized version for iGEM, BBa_K3730000.
We found that the original plasmid (= non-optimized) had a XbaI site, which we used to insert our BioBrick BBa_K3037003. This ilegal restriction site was later removed with an overhang PCR. The original XbaI restriction site was positioned downstream of the T7 polymerase promoter and upstream the RBS sequence of the plasmid. This way only BioBricks that already has a RBS fused to them could be expressed. Since we were using the RFC25 standard of Freiburg for our fusion proteins, the inserted protein contained already its own RBS in the Prefix.
However, we experienced on our own how difficult it is to add such a small sequence, as an RBS, to our other constructs. Therefore we redesigned the plasmid to be ready for expression in a single digestion+ligation reaction. We removed the XbaI restriction site and included a Prefix and Suffix of the RFC 10 standard after the RBS of the plasmid (=optimized).
We used the BioBrick assembly method to insert our BioBrick BBa_K3037003, which also has its own RBS due to the RFC25 standard.
In Figure 3, we show the expression of the protein BBa_K3037003 using both plasmids optimized (left) and non-optimized (right) and also different IPTG concentrations for induction and temperature.
Figure 3: Comparison of the growth curves of optimized and non optimized pOCC97 at different temperatures and IPTG concentrations as stated.
The comparison of the growth curves shows that, the new plasmid adapted to the RFC 10 standard did not affect the growth, as it shows similar behavior compared to the original one (Figure 4).
Figure 4: Comparison of the growth curve of E. coli carrying optimized and non optimized pOCC97. Induction was performed with 1 mM IPTG
Down below follow several SDS-PAGEs of loaded crude cell extract (all normalized to an OD of 0.5) harvested at different time points pre- and post-induction. Used IPTG concentrations are indicated. Arrows indicate predicted size of the protein of interest.
Comparison of the expression of MBP-HRP (BBa_K3037008) and Full Construct (BBa_3037003)
Figure 5: SDS-PAGE results for comparison of expression of different proteins in the vector before and after optimization
Expression of full construct in pOCC97 not optimized at 18ºC
Figure 6: SDS-PAGE results for comparison of expression of fusion protein BBa_K3037003 at 37ºC before optimization
Expression of Full Construct in pOCC97 at 37ºC
Figure 7: SDS-PAGE results for comparison of expression of fusion protein BBa_K3037003 at 37ºC before optimization
Figure 8: SDS-PAGE results for comparison of expression of fusion protein BBa_K3037003 at 37ºC before optimization (induction with 0.5mM IPTG)
Expression of Full Construct in pOCC97 optimized
Figure 9: SDS-PAGE results for comparison of expression of fusion protein BBa_K3037003 after optimization
The previously shown SDS-pages were then further analysed by using the software ImageJ to correct for loading differences and be able to draw conclusions about the best conditions to express the Full Construct in pOCC97.
Temperature and IPTG induction dependence of the optimized pOCC97
Figure 10: Expression of the Full Construct in optimized pOCC97 under different conditions.
Temperature and IPTG induction dependence of the not optimized pOCC97
Figure 11: Expression of the Full Construct in not optimized pOCC97 under different conditions.
Comparison between optimized and not optimized pOCC97
Figure 12: Comparison between the expression of optimized and not optimized pOCC97.
Comparison between optimized and not optimized pOCC97
Based on this analysis, it can be concluded that optimal conditions for the expression of our fusion protein, BBa_3037003, is an overnight expression at 18ºC and inducing with 0.5 mM IPTG. We are proud to say that our optimized pOCC97 shows an increased expression and robustness under various conditions tested.
Characterization
Outline
We performed the purification of an MBP-tagged fusion protein as characterization experiment.Experiments in Detail
A fusion protein (BBa_K3037003) with the size of 230 kDa was expressed. N-terminally it was tagged with this MBP-tag. The digestion to prepare the ligation was carried out with the restriction enzymes NgoMIV and AgeI (Freiburg RFC25 standard), which are ensuring translational fusion. After the expression of the protein, the MBP-tag was deployed for purification (Figure 1).
Figure 1: Purification of 230kDa fusion protein on amylose resin
The elution fractions contain a lot of different sized proteins. It is very likely that this is not due to a lack of specificity of the amylose-MBP interaction but due to many truncated versions that are produced of the huge fusion protein.
Another fusion protein with MBP was made, this one of 220 kDa protein (BBa_K3037005). It was purified using the same method in an amylose resin column with the a N-terminal-MBP-tag (Figure 2).
Figure 2: Amylose resin purification
The comparison of lane 4 and 5 illustrates nicely the performance of the MPP-tag with the amylose resin. Upon elution in lane 5 many truncated versions appear. This was to be expected as it often occurs when expressing large recombinant proteins. The high intensity of the bands shows that previously these proteins were bound to the resin as they were not in lane 4. After the digestion with 3C protease, a very strong signal appears at 42 kDa inicating that the preScission sites are intact and were recognized. The purification of the complete transcript from the cleaved off tag was archieved by cation exchange chromatography on a HiTrap SP column.
Overview
The following characterization experiment was performed to prove the DNA-binding ability of dCas9 via an Electrophoretic Mobility Shift Assay (EMSA) (Performed with BBa K3037005).
Experiments in Detail
100 ng of PCR amplified sry gene
200 ng of dCas9-GFP
200 ng of guide RNA specifically targeting the amplified sry gene
1 x Reaction buffer - 20 mM Hepes buffer (pH 7.2)
100 mM NaCl
5 mM MgCl2
0.1 mM EDTA
Six different guide RNAs were designed for targeting different regions of sry gene. Using the online tool Benchling and Fasta sequence of sry gene (Table 1).
1: AACTAAACATAAGAAAGTGA
2: GAAAGCCACACACTCAAGAA
3: ACTGGACAACAGGTTGTACA
4: GTAGGACAATCGGGTAACAT
5: TTCGCTGCAGAGTACCGAAG
6: CCATGAACGCATTCATCGTG
Table 1: Overview of different guide RNAs with the context of the sequence and the PAM sequence
1. We wanted to check if the overall efficiency of mobility shift increases when combinations of guide RNAs are used.
2. Guide RNA, dCas9-GFP and sry gene were incubated in reaction buffer (respective amounts mentioned in the materials section) for 37 °C for 1 hour.
3. Post incubation, they were mixed with loading dye without SDS, 20 % glycerol in Orange G dye and loaded onto 4-20 % gradient acrylamide- TBE precast gel. Two gels were run for two and 3 hours at 75V in 1x TBE buffer.
4. Gel was then stained using EtBR with 1:20000 dilution in 1x TBE for 10 minutes.
Figure 1: Electrophoretic Mobility Shift Assay (EMSA) after a two hour run using dCas9 with different guideRNAs
Lane 1+2 - There is a clear sry band at 800 base pairs and when the sry gene is incubated with only dCas9 without guideRNA. Over all, no shift is observed.
Lane 3 - When guideRNA 1 was incubated with the dCas9 DNA reaction mix, we saw a shift in the mobility, this is because of the protein DNA interaction and this binding is hindering the gene mobility.
Lanes 5,6,7,8 and 9 – Different combinations of guide RNAs were used. From lane 7 and 8 we see the highest mobility shift.
From the electromobility shift assay performed above, we conclude that our expressed dCas9-GFP protein is functional and is able to successfully bind to gene with the help of appropriate guideRNAs.
Figure 2: Electrophoretic Mobility Shift Assay (EMSA) after a three hour run of the dCas9 with different guideRNAs
This second gel was run longer in order to get rid of all the secondary structures derived from residual RNA fragments.
From lane 3 to 7, no difference in the mobility of sry gene can be seen when only guideRNA is added to the reaction mix.
In Lane 8, 9 and 10 a mobility shift of the gene can be observed and in lane 11, when only guideRNA was loaded no bands were obtained.
In lane 12, dCas9 is in the stacking part of gel, owing to higher molecular weight.
The following experiment was performed in the composite BioBrick (BBa_3037003) The DNA binding activity of the dCas9 contained in our Full Construct was proven via EMSA. Our dCas9 is expected to bind to the sry gene, since the guide RNA was specifically designed to target this gene. In Figure 3, it can be clearly seen how at very high concentrations of expressed Full Construct, our dCas9 is able to completely bind to the sry gene, fully hindering its mobility through the gel (red box).
Figure 3: Proof of the binding of our Full Construct (with its dCas9) to the DNA sequence of interest (SRY gene in this experiment).
In order to determine the lowest concentration at which our expressed Full Construct causes the pull of the gene, different concentrations were loaded on the gradient TBE acrylamide gel. We found that at approximately 1.28 ug the dCas9 is able to bind and therefore, pull up the DNA. Additionally, at 8.56 ug we can see a very clear shift of the DNA, since it can be seen in the region marked with a red box in Figure 4.
Figure 4: Determination of the lowest concentration of the Full Construct (with dCas9) needed to bind and pull DNA
Based on this analysis, it can be concluded that optimal conditions for the expression of our fusion protein, BBa_3037003, is an overnight expression at 18ºC and inducing with 0.5 mM IPTG. We are proud to say that our optimized pOCC97 shows an increased expression and robustness under various conditions tested.
Outline
We performed the following characterization experiments:
1) Expression of the Full Construct in pOCC97 (BBa_K3037000): monitoring growth of E.coli
2) SDS-PAGEs for the expression assay over the time of Full Construct (BBa_K3037003)
3) Image analysis of the expression in the SDS-PAGEs with ImageJ
4) Characterization of the single parts of the Full Construct
Experiments in Detail
Once all the single parts were fused together, the Full Construct was cloned into our expression plasmid pOCC97 (BBa_K3037000). The correct insertion of our Full Construct into the plasmid was proven via restriction digest followed by agarose gel electrophoresis. For that, we performed a triple digest with PmlI, XbaI and PstI and got several positive clones. This simulation of the digest in SnapGene is depicted in Figure 1.
Figure 1: Multiple Full Construct clones digested with PmlI, XbaI and Pst-1. On the right, the simulation in SnapGene is shown. The positive clones are marked with red crosses.
Furthermore, it was proven that the E. coli could grow normally after the induction of the fusion protein. For this matter, the development of the bacteria cultures was monitored by measuring the OD at 600 nm during different time points before and after induction with 1 mM IPTG.
As shown in Figure 2, the growth of the bacteria is not affected by the expression of the protein. Important to note, the expression of the Full Construct was performed in two slightly different pOCC97 plasmids, that differ in their Ribosome Binding Site (RBS) and compatibility to the RCF10 BioBrick standard. Hereinafter, they are going to be referred to as optimized and not optimized (read the registry page BBa_K3037000 for more details regarding the difference between these two plasmids).
Figure 2: Comparison of the growth curve compared before and after optimization
To go further, the expression of the Full Construct in pOCC97 at different temperatures was studied. Also, the optimized and not optimized pOOC97 were compared. Both is visualized in Figure 3.
Figure 3: Comparison of the growth curves of optimized and not optimized pOCC97.
After proving that the final construct was well inserted in our plasmid, it was expressed overnight. The first expression, performed at 37°C for seven hours was induced with 1 mM IPTG. The result is shown in Figure 4:
Figure 4: SDS-page showing the expression of the Full Construct in pOCC97 after induction with 1 mM IPTG. Different type points show the increased expression of the Full Construct (marked with black arrow).
To compare the best expression conditions, the same experiment was repeated several times at different temperatures and IPTG concentrations in both plasmids. The results are shown in Figures 5 to 7.
Expression of Full Construct in pOCC97 not optimized at 18ºC and different IPTG concentrations
Figure 5: Expression of the Full Construct in not optimized pOCC97 at 18ºC. The timepoints 0 to 3 relate to 1,2,3 and 10 h post induction respectively. IPTG was added in concentrations of 0.2 nmM, 0.5 mM and 1 mM. The black arrow is corresponding to the band at the expected protein size of 230 kDa.
Expression of Full Construct in pOCC97 not optimized at 37ºC and different IPTG concentrations
Figure 6: Expression of the Full Construct in not optimized pOCC97 at 37ºC. The timepoints 0 to 3 relate to 1,2,3 and 10 h post induction respectively. IPTG was added in concentrations of 0.2 nmM, 0.5 mM and 1 mM. The black arrow is corresponding to the band at the expected protein size of 230 kDa.
Expression of the Full Construct in pOCC97 optimized at different temperatures and IPTG concentrations
Figure 7: Expression of the Full Construct in optimized pOCC97 at different temperatures and IPTG concentrations. The timepoints 0 to 3 relate to 1,2,3 and 10 h post induction respectively. IPTG was added in concentrations of either 0.5 mM or 1 mM. The cutures were grown at 37°C or 18°C as indicated in the figure. The black arrow is corresponding to the band at the expected protein size of 230 kDa.
The previously shown SDS-PAGEs were further analysed by using the software ImageJ to correct for loading differences and to be able to draw conclusions about the best conditions to express the Full Construct in pOCC97.
Temperature and IPTG induction dependence of the optimized pOCC97
Figure 8: Expression of the Full Construct in optimized pOCC97 under different conditions.
Figure 8 indicates that at 18°C an induction with 0.5 mM IPTG results in higher yields in the optimized pOCC97 compared to an induction with 1 mM. Even if at 37°C the amount of protein expression rises faster, after overnight incubation more protein is produced in the 18°C culture.
Temperature and IPTG induction dependence of the not optimized pOCC97
Figure 9: Expression of the Full Construct in not optimized pOCC97 under different conditions.
The experiments for the not optimized pOCC97 showed a different preference, here the yields are if grown at 37°C unless induction is done with 1 mM IPTG.
Comparison between optimized and not optimized pOCC97
Figure 10: Comparison between the expression of optimized and not optimized pOCC97.
Based on the analysis of Figures 8 to 10 it can be concluded that the optimal conditions for the expression of BBa_3037003 in pOCC97 are 18ºC and 0.5 mM IPTG. The expression seems to be more stable over time for the optimized plasmid than for the non optimized.
a) Purification via MBP
After ensuring that the Full Construct is expressed properly in our plasmid by improving its expression conditions, it was purified by using amylose resin to bind its MBP site. To test for the correct functioning of the MBP-tag of the fusion protein we performed different experiments. For that, two different protocols were used. On the one hand, an amylose resin column was used, and on the other hand, a batch binding solution was prepared. Better results were obtained with the latter one. For the batch binding, the resin was pipetted into a falcon and incubated with the cell lysate for 1.5 hours on a rotator at 4°C. The SDS-PAGE of the purification steps is shown in Figure 11.
Figure 11: SDS-PAGE of purification of Full Construct (indicated by the black arrow) with MBP-tag and an amylose resin batch binding step.
b) Activity assay of HRP
The inverstigation of the activity of HRP in the Full Construct was done in a dynamic assay. The absorbance at 650 nm was measured over time with the substrate TMB. TMB is a colorless solution but is converted into a blue product by oxidation through HRP. Furthermore, the addition of hydrogen peroxide catalyses the oxidation of the TMB. It acts as a electron donor, enhancing the formation of the blue product. The reaction can be stopped by adding an acidic solution (for example: HCl), resulting in a yellow coloured-readout. (See more information about the HRP activity in BBa_K1800002) To prove the correct activity of the HRP in our Full Construct we performed mechanical lysis on our E.coli cells that were expressing our fusion protein, added the HRP substrate TMB followed by the addition of hydrogen peroxide and stopped the reaction by adding HCl. E.coli expressing our MBP BioBrick were used as a negative control. The result can be seen very nicely in the following video:
To further verify the correct activity of the HRP, the absorbance at 650 nm of both cell lysates was measured. As it can be seen in Figure 12, the cell lysate that is expressing MBP showed a much lower absorbance at 650 nm, than the lysate containing the Full Construct. This means, that the HRP contained in Full Construct is working properly.
Figure 12: Absorbance measured at 650 nm of cell lysates with and without Full Construct after TMB addition.
Based on the analysis of Figures 8 to 10 it can be concluded that the optimal conditions for the expression of BBa_3037003 in pOCC97 are 18ºC and 0.5 mM IPTG. The expression seems to be more stable over time for the optimized plasmid than for the non optimized.
c) dCas9 activity
The DNA binding activity of the dCas9 contained in our Full Construct was proven via EMSA. Our dCas9 is expected to bind to the sry gene, since the guide RNA was specifically designed to target this gene. In Figure 14, it can be clearly seen how at very high concentrations of expressed Full Construct, our dCas9 is able to completely bind to the sry gene, fully hindering its mobility through the gel (red box).
Figure 14: Proof of the binding of our Full Construct (with its dCas9) to the DNA sequence of interest (SRY gene in this experiment).
In order to determine the lowest concentration at which our expressed Full Construct causes the pull of the gene, different concentrations were loaded on the gradient TBE acrylamide gel. We found that at approximately 1.28 ug the dCas9 is able to bind and therefore, pull up the DNA. Additionally, at 8.56 ug we can see a very clear shift of the DNA, since it can be seen in the region marked with a red box in Figure 15.
Figure 15: Determination of the lowest concentration of the Full Construct (with dCas9) needed to bind and pull DNA
d) Strep-tag column purification
The reason to include a Strep-tag at the end of our Full Construct was to facilitate its purification. However, as already explained in the Registry page of the Strep-tag itself BBa_K823038, this BioBrick seems to not be working properly for column purification. The Strep-tag was developed to be used for Western Blots and not for column purification. That is why the purification via Strep-tag did not work (see Figure 16). However, it was shown in the section before, that we were able to successfully purify our Full Construct via the MBP.
Figure 16: Different Full Construct samples before, while and after Strep purification
The TU Dresden team 2019 used this linker to make the fusion proteins (BBa_K3037005) and (BBa_K3037003).
This part, encodes for a linker used in between translationally fused proteins. The amino acid composition is "GSAGSAAGSG". The high amounts of glycine and serine residues make it a very flexible linker.
Outline
We performed the following characterization experiments:
1) Expression using pOCC97 (BBa_K3037000) in E. coli pRARE T7 - Proof of the correct functioning of GFP
2) Construct purification and tag-removal - Proof of the correct functioning of MBP
3) Proof of DNA-binding ability of dCas9 via Electrophoretic Mobility Shift Assay (EMSA) - Proof of the correct functioning of dCas9
4) Measurement of fluorescence
Experiments in Detail
As a quick and easy proof of principle experiment, we used our over-expression plasmid pOCC97 ([http://parts.igem.org/Part:BBa_K3037000 BBa_K3037000) and introduced our construct (BBa_K3037005). After inducing expression in growing E.coli cells with IPTG, we took a sample, transferred it into an Eppendorf tupe and showed that these E.coli cells glow upon excitation with UV light (Figure 1). Thus, we concluded that our construct of MBP+eGFP+dCas9 was expressed successfully.
Figure 1: Expression of BBa_K3037005 in pOCC97
The protein was purified via an amylose resin column with the a N-terminal-MBP-tag BBa_K3037001 (Figure 2).
Figure 2: Amilose resin purification using MBP-tag. The upper arrow shows the location in the gel of this BioBrick (BBa_K3037005). The lower ones show the MBP-tag after beeing cleaved off
The comparison of lane 4 and 5 illustrates nicely the performance of the MPP-tag with the amylose resin. Upon elution in lane 5 many truncated versions appear. This was expected since it often occurs when expressing large recombinant proteins. The high intensity of the bands shows that previously these proteins were bound to the resin as they were not in lane 4. After the digestion with 3C protease, a very strong signal appears at 42 kDa indicating that the preScission sites are intact and were recognized. The purification of the complete transcript from the cleaved off tag was achieved by cation exchange chromatography on a HiTrap SP column.
1. Materials:
100 ng of PCR amplified sry gene
200 ng of dCas9-GFP
200 ng of guide RNA specifically targeting the amplified sry gene
1 x Reaction buffer - 20 mM Hepes buffer (pH 7.2)
100 mM NaCl
5 mM MgCl2
0.1 mM EDTA
Six different guide RNAs were designed for targeting different regions of sry gene. Using the online tool Benchling and Fasta sequence of sry gene (Table 1).
1: AACTAAACATAAGAAAGTGA
2: GAAAGCCACACACTCAAGAA
3: ACTGGACAACAGGTTGTACA
4: GTAGGACAATCGGGTAACAT
5: TTCGCTGCAGAGTACCGAAG
6: CCATGAACGCATTCATCGTG
Table 1: Overview of different guide RNAs with the context of the sequence and the PAM sequence
2. Methods:
1. We wanted to check if the overall efficiency of mobility shift increases when different combinations of guide RNAs are used.
2. Guide RNA, dCas9-GFP and sry gene were incubated in reaction buffer (respective amounts mentioned in the materials section) for 37 °C for 1 hour.
3. Post incubation, they were mixed with loading dye without SDS, 20 % glycerol in Orange G dye and loaded onto a 4-20 % gradient acrylamide- TBE precast gel. Two gels were run for 2 and 3 hours at 75 V in 1 x TBE buffer.
4. Gel was then stained using EtBr with 1:20000 dilution in 1x TBE for 10 minutes.
3.1 Results and Discussion of the 2 hours gel:
Figure 3: Electrophoretic Mobility Shift Assay (EMSA) after a two hours run using dCas9 with different guideRNAs.
Lane 1+2 - There is a clear sry band at 800 base pairs and when the sry gene is incubated only with dCas9 without guideRNA. Over all, no shift is observed.
Lane 3 - When guideRNA 1 was incubated with the dCas9 DNA reaction mix, we saw a shift in the mobility caused by the protein DNA interaction. The binding hinders the DNA mobility.
Lanes 5, 6, 7, 8 and 9 – Different combinations of guide RNAs were used. From lane 7 and 8 we see the highest mobility shift.
From the electromobility shift assay performed above, we conclude that our expressed dCas9-GFP protein is functional and is able to successfully bind to DNA with the help of appropriate guideRNAs.
3.2 Results and Discussion of the 3 hours gel:
Figure 4: Electrophoretic Mobility Shift Assay (EMSA) after a three hour run of the dCas9 with different guideRNAs
This second gel was run longer in order to remove all the secondary structures derived from residual RNA fragments.
From lane 3 to 7, no difference in the mobility of sry gene can be seen when only guideRNA is added to the reaction mix.
In lane 8, 9 and 10 a mobility shift of the gene can be observed and in lane 11, where only guideRNA was loaded no bands were obtained.
In lane 12, dCas9 is in the stacking part of gel, corresponding to higher molecular weight.
4. Conclusions:
- We have a functional dCas9 expressed, which is able to bind successfully to sry gene with the help of specific guideRNAs.
- dCas9 on its own is unable to bind to sry gene, proving that for binding at least one appropriate guideRNA is required.
- GuideRNAs on their own are unable to cause a mobility shift of the sry gene.
From the cell lysate, the functionality of eGFP in the fusion protein was analyzed. First of all, the excitation and emission spectrum were measured with Tecan Plate Reader (Bandwith 20 nm) (Figure 5). The excitation maxima was screened from 400 to 490, being the final excitation maxima 480 nm. The emission maxima was measured from 500 to 600 nm with a final result of 512 nm.
Figure 5: Fluorescense spectrum measurement. Excitation maxima 480 nm. Emission maxima 512 nm.
The protein functionality of eGFP in the fusion protein was analyzed in the protein purified using the MBP-tag. First of all, the excitation and emission spectrum were measured with Tecan Plate Reader (Bandwith 20 nm) (Figure 5). The excitation maxima was screened from 400 to 490, being the final excitation maxima 480 nm. The emission maxima was measured from 500 to 600 nm with a final result of 512 nm.
Figure 5: Fluorescense spectrum measurement. Excitation maxima 480 nm. Emission maxima 512 nm.
Outline
We performed the following characterization experiments:
1) Growth curve of expression in pOCC97 (BBa_K3037000) in E. coli pRARE T7
2) Determination of the total protein concentration of cleared lysate after expression assay of the substrate conversion (TMB) compared to (BBa_K1800002)
3) Protein Expression monitored via SDS-PAGE
4) Activity assay of the substrate conversion TMB compared to (BBa_K1800002)
Experiments in Detail
The HRP was expressed using the plasmid pOCC97 as a backbone (BBa_K3037000)
The purpose of this experiment was to show that the Escherichia coli pRARE T7 grows normally after the induction of HRP expression.
For this, growth of bacteria was monitored by measuring the Optical absorbance at 600 nm during different time points before and after induction with 1 mM IPTG. As shown in the following Figure, the Escherichia coli growth is not affected by the expression of the protein. It shows a normal growth behaviour as expected in a batch culture (Figure 1).
Figure 1: Growth curve of Escherichia coli before and after expressing HRP. Vector pOCC97 (BBa_K3037000). Induction with 1mM IPTG
In order to determine the total protein content of the cleared lysate after the expression the following assay was performed. First, the standard curve was done with the Pierce BCA protein assay kit of Thermo Scientific (#23225) (Figure 2).
Figure 2: Calibration curve with known BSA concentrations in order to determine the concentrations of our samples.
Then different cultures of E. coli pRARE T7 transformed with different BioBricks using pOCC97 (BBa_K3037000) as a vector were set. The BioBricks used were:
A fusion protein of MBP and HRP (BBa_K3037008)
This HRP but in the RFC10 standard (BBa_K1800002)
This HRP adapted to the RFC25 standard (BBa_K3037007)
Then a culture of 100 mL E. coli pRARE T7 transformed with the different BioBricks was cultivated until the OD reached 0.5, then the culture was induced with 0.5 mM IPTG and 6 hours after that it was spun down. The pellet was stored at -80 degrees and left overnight. The next day the cells were lysed and the supernatant was taken to measure the protein concentration. The results were compared with the standard curve to calculate the concentration as shown in Figure 3.
Figure 3: Protein concentration of HRP measured in the cleared lysate of E. coli pRARE T7 carrying the expression backbone pOCC97 (BBa_K3037000) with different inserts. Expression was induced 0.5 mM IPTG
A culture of 100 mL Escherichia coli pRARE T7 were transformed with the HRP BioBrick inside pOCC97 (BBa_K3037000), they were cultivated until the absorbance reached 0.5. Samples before induction were taken. Then the culture was induced with 0.5 mM IPTG,every 30 minutes samples were collected (5 samples), then 3 more each 1 hour. Before making the SDS-PAGE, the samples were adjusted to absorbance of 0.5 to have the same amount of cells in each lane. By doing so, the increase of a specific protein can be observed. The results show the increase of the concentration of the protein in time (Figure 4).
Figure 4: SDS-PAGE of the expression of HRP (BBa_K3037007) in the vector pOCC97 (BBa_K3037000). Upper anotations showing the different times of induction in minutes. The protein band is marked with an arrow
As it can be seen in the SDS-PAGE, the protein of interest is increasing over time from the point of induction onwards. HRP is marked with a black arrow pointing left.
The conversion of transparent TMB substrate to blue reaction product was monitored at 370 nm over half an hour with absorption measurements every 60 seconds for the HRP adapted to the RFC10 standard (BBa_K1800002) and to the RFC25 (BBa_K3037007) (Figure 5)
Figure 5: Activity assay of HRP in different iGEM standards expressed in pOCC97 (BBa_K3037000) monitored at 370 nm measuring every 60 seconds.
As it can be seen in the graph, the activity of this BioBrick and the original one from which it was adapted from are not different. This was our expected result, since the sequences are the same and only the prefix and suffix were changed from RCF10 to RCF25.
Outline
We performed the following characterization experiments:
1) Expression in pOCC97, growth curve (BBa_3037000)
2) Expression in pOCC97, SDS-PAGE (BBa_3037000)
Experiments in Detail
Figure 1: Growth curve (Normal bacterial Growth curve is seen during the expression of MBP-HRP)
Expression of MBP-HRP seen in the graph (right)
Figure 2. SDS-PAGE (Comparison of expression of full construct (BBa_K3037003) and MBP-HRP (BBa_K3037008) in the pOCC97 (BBa_K3037000) before and after optimization)
HRP
Since the HRP-Strep part is a composite part, the correct functioning of the HRP activity was already characterized individually. Please check for that the characterization of this BioBrick BBa_K3037007.
HRP
The Strep-tag BBa_K823038 was supposed to be used for purification.
The protocol used was “Expression and purification of proteins using Strep-Tactin” of IBA Lifescience [1] preparing the same buffers described in this protocols without EDTA to not harm the activity of HRP. From the results of the purifications we concluded that the Strep-tag is not working properly for column purification and should therefore only be used for Western Blots. See more information regarding this in the original registry of this BioBrick (BBa_K823038), and see Figure 1 for this concrete construct.
Figure 1: Growth curve (Normal bacterial Growth curve is seen during the expression of MBP-HRP)
our great sponsors
We are proudly sponsored by the following partners in science:
