Team:Strasbourg/Results
Results
Bacterial three-hybrid system results
Aptazyme Cloning
To validate the designed constructs, we decided to test two different aptazymes: Theophylline switch-off (stop self-cleavage in presence of ligand) and Guanine switch-on (active self-cleavage in presence of ligand). For the negative control, we chose an inactive form of the aptazyme with a mutation at the ribozyme domain. iGEM Strasbourg designed construct requires the use of aptazyme linked to MS2 and PP7 stem-loops. To link aptazymes Theophylline active , Theophylline inactive, Guanine active and Guanine inactive to MS2 and PP7 stem loops we decided to use Gibson Assembly method. The amplification was done in XL1 Blue competent cells. The aptazymes sequences in which 3’ and 5’ extremities are complementary to pKB1094, the plasmid containing MS2-MS2-PP7-PP7 stem-loops (BBa_K2923000), were ordered from IDT (Table 1).
Table 1. Aptazyme with overlapping sequences for Gibson Assembly Overlapping sequences are in blue. Inactivation mutations are in green.
| Name | Sequence |
|---|---|
| Aptazyme Guanine Active | tgaggatcacccatgtctgcagcccTTCTCCTTCGGTACATCCAGCTGATGAGTCCCAAATAGGACGAAAAAA
|
| Aptazyme Guanine Inactive | tgaggatcacccatgtctgcagcccTTCTCCTTCGGTACATCCAGCTGATGAGTCCCAAATAGGACGAGAAAATATAATCGC
|
| Aptazyme Theophylline Active | tgaggatcacccatgtctgcagcccCTCCTTTAAAGCGGTTACAAGCCCGCAAAAATAGCAGAGTAAACCCA
|
| Aptazyme Theophylline Inactive | tgaggatcacccatgtctgcagcccCTCCTTTAAAGCGTGTACAAGCCCGCAAAAATAGCA
|
The presence of successive similar sequences (two MS2 or PP7 stems loops) can lead to the mismatch of aptazyme insertion and loss of one of the stem-loops. To check the presence of all construct’s elements (MS2-MS2-Aptazyme-PP7-PP7) the Gibson assembly products were analyzed by 2% agarose gel (Example of Theophylline active: Fig.1). The clones 6,9,10 were selected to be analyzed by sequencing and for further experiments.
Figure 1: MS2-MS2-Theophylline active-PP7-PP7 aptazyme Gibson Assembly profile on 2% agarose gel. Twelve clones from Gibson assembly on Theophylline active aptazyme were analyzed on the agarose gel. The highest bands correspond to MS2-MS2-Aptazyme-PP7-PP7 (4103 bp). The intermediate bases correspond to MS2-Aptazyme-PP7-PP7 (4073 pb) and the lowest band corresponds to pKB1094 plasmid without insert (4009 pb). pKB1094 used as the negative control. The blue arrows show selected clones. To observe the others aptazymes see Lab Book
IN-VITRO ASSAYS
Aptazymes fused to PP7 and MS2 catalytic activity assay
In our constructs, the aptazyme is linked to two PP7 stem loops at the 5’ site and 2 MS2 loops at the 3’ site. To validate that the presence of MS2 and PP7 stem-loops have not negative effects on aptazyme cleavage ability, we performed in vitro analysis. After 1h30 of in vitro transcription, the samples were analyzed in an 8% polyacrylamide gel with urea (Fig.2).
Figure 2: Aptazyme catalytic activity assay : Theophylline and Guanine aptazyme were transcribed in vitro for 1h30 in presence of DNA blocker (25 μM blocking strand (5′-TACTCTGCTATTTTTGCGGGCTTGTA-3′)) to avoid aptazyme self-cleavage. RNA was analyzed in an 8% polyacrylamide gel with urea. The inactive form of Theophylline and Guanine aptazymes represent the whole RNA and correspond to the band of 94 pb and 138 pb, respectively. Cleaved aptazyme represents the two parts of the aptazyme [ for Theophylline (18 pb + 76 pb) and for Guanine (28 pb + 110 pb)].
Despite the presence of a DNA blocker, both active aptazymes were already cleaved compared to their inactive forms. According to Jorg Hartig [1], guanine and theophylline aptazymes are sensitive to Mg2+, and this was not considered in our in vitro transcription protocol.
Nevertheless, in vitro assay showed that PP7-Aptazyme-MS2 constructs had kept 100% of their ribozyme activity. We confirmed that modified aptazymes kept a correct catalytic activity in presence of MS2 and PP7 stem loops. Moreover, the inactive aptazymes did not present an aptazyme catalytic activity, which confirms their use as an efficient negative control.
IN-VIVO ASSAYS
ß-galactosidase assay optimization
A ß-galactosidase assay was performed to quantify the reporter gene transcription induced by aptazyme catalytic activity. Before starting the in vivo experiment on aptazymes, we characterized the constructs created by Berry and Hochschild [2] as positive and negative controls.
A triple transformation of FW102 OL2-62 strain with Berry’s plasmids lambdaCI-MS2coat protein, AlphaNTD-PP7coat protein and MS2-MS2-RNA-PP7-PP7 (full hybrid RNA) were performed to obtain a ß-galactosidase activity positive control, that we called BH3. The triple transformation of FW102 OL2-62 strain with Berry’s plasmids lambdaCI-MS2cp, AlphaNTD-PP7cp PP7 and pKB1094 empty plasmid (MS2 and PP7 stem loops were left out) were performed to obtain a ß-galactosidase activity negative control, that we called BH2.
The ß-galactosidase assay was performed according to published protocol, with one difference: the OD measurement was performed in cuvettes and not in 96-well plates. After several ß-galactosidase assays, the best-obtained result was a ∼ 2-fold increase in BH3 activity compared to the basal activity for BH2 (Fig.3). These results do not correspond to those of Berry and Hochschild as they obtained a 6-fold difference between BH2 and BH3 constructs [2]. After looking at the literature and discussing with our PIs, we decided to optimize the protocol by changing the bacterial lysis solution and decreasing the time of incubation (see iGEM Strasbourg protocols). With optimized protocol, we obtained the expected ∼ 6-fold difference between BH3 and BH2 (Fig.4).
Figure 3: ß-galactosidase assay results with original protocol. The ß-galactosidase activity analyzed by the original protocol was measured thanks to a colorimetric assay, n=3.
Figure 4. ß-galactosidase assay results with modified protocol. The ß-galactosidase activity analyzed by the optimized protocol was measured thanks to a colorimetric assay, n=3.
The optimized protocol is available for further MS2-MS2-Aptazyme-PP7-PP7 investigation in iGEM Strasbourg team protocols.
ß-galactosidase assay on active and inactive aptazymes in absence of ligand
The ß-galactosidase activity depends on aptazyme activity: the aptazyme cleavage stops the recruitment of polymerase and inhibits LacZ transcription (see Fig.1, Our scientific strategy, Description BH3 Project). A ß-galactosidase assay without ligand was performed to characterize the aptazyme compatibility with the chosen bacterial three-hybrid system. To do so, the triple transfection was performed with iGEM constructed plasmids and Berry's plasmids on FW102 OL2-62 strain (Fig.5).
Figure 5: triple transformation of FW102 OL2-62 strain with Berry’s plasmids
First, we analyzed the guanine aptazyme, a switch-on aptazyme (i.e. it activates ß-galactosidase transcription in the presence of ligand). Inactive guanine aptazyme was used as a negative control. Previously described BH2 and BH3 were used as positives and negatives controls, respectively (Fig.6). No result was observed for Guanine active aptazyme and its inactive form. It does not have significant ß-galactosidase activity levels compared to positive control (BH3).
Figure 6: ß-galactosidase assay on Guanine aptazyme in absence of ligand
Theophylline aptazyme, a switch-off aptazyme (i.e. it cleaves itself in absence of ligand and prevents ß-galactosidase transcription) was analyzed in the presence of its inactive form as well as BH2 and BH3 controls (Fig.7).
Figure 7: ß-galactosidase assay on Theophylline aptazyme in absence of ligand, n=3
Theophylline aptazyme has a ß-galactosidase activity profile similar to controls. The active theophylline aptazyme cleaves itself, witch prevents the reporter gene transcription. The inactive aptazyme unites all the construct elements and thus active ß-galactosidase transcription. These data confirm that aptazymes can be compatible with three-hybrid systems and modulate reporter gene transcription under real conditions. Because of the guanine aptazyme results, we used only the theophylline aptazyme as a ligand sensor in further experiments.
ß-galactosidase assay in the presence of ligand
To investigate theophylline aptazyme in vivo activity we chose a 2.5mM concentration for the theophylline, which is the one recomanded by Felletti et al., 2016 [1]. We performed the ß-galactosidase assay with its negative control as well as BH2 and BH3 controls, all incubated with the same concentration of theophylline (Fig.8). We obtained the expected results for all controls, which shows that theophylline did not have any effect on the three-bacterial hybrid system. However, the active form of the theophylline aptazyme does not seem to be sensitive to its ligand. No significant increase of ß-galactosidase activity was observed in the presence of theophylline compared to an inactive control.
Figure 8: ß-galactosidase assay with theophylline aptazyme in presence of theophylline (2.5 mM)
ß-galactosidase assay with higher ligand concentration
The in vivo investigations of aptazyme activity are complex. The quantity of theophylline in media does not correspond to its concentration in the bacterial cells. To increase the chances to see an interaction between the theophylline aptazyme and its ligand, we chose to perform the same experiment with a higher theophylline concentration (5mM) (Fig.9). However, the obtained results showed that the theophylline aptazyme does not respond to its ligand presence.
Figure 9: ß-galactosidase assay on theophylline aptazyme in presence of theophylline (5 mM), n = 3
Conclusion
In-vitro : Our designed aptazyme with modified extremities with PP7 and MS2 maintains its catalytic activity: MS2-MS2-Aptazyme-PP7-PP7 have 100% cleavage activity compare to an inactive aptazyme.
In-vivo : The theophylline aptazyme is compatible with Berry’s three-hybrid system. The aptazyme interacts with PP7 and MS2 coat proteins and its cleavage is able to prevent reporter gene transcription (here, lacZ). The used aptazyme activity induction protocol was optimized (see Discussions).
LexA repressor system results
In order to use the MS2-MS2-Aptazyme-PP7-PP7 in a LexA repressor system, we tried to fuse LexA with wild type DNA binding domain to the PP7 coat protein and LexA with the mutated version of DNA binding domain to the MS2 coat protein. To design the fusion protein without affecting LexA functionality we performed a bibliographic research of MS2cp/PP7cp-LexA fusion. We found that its linkage was already investigated by SenGupta et al., in 1996 [3]. In this study, MS2 is linked to LexA by 9 amino-acid linkers Gly-Ala-Pro-Gly-Ile-His-Pro-Gly-Met (GGTGCGCCGGGTATCCACCCGGGTATG) at the N-terminal extremity.
Unfortunately, in a 1998 study, Dimitrova et al. used the C-terminal extremity for LexA repressor system [4], without publishing the plasmid sequence. iGEM Strasbourg sequenced and reconstructed Dimitrova’s pSR659 and pSR658 plasmids.
MS2cp and PP7cp were purified on agarose gel and cloned by Gibson assembly. Gibson assembly products were transfected into DH5alpha. Five clones from each Gibson reaction were sequenced. Unfortunately, no sequenced clones had the correct constructions (PP7cp or MS2cp were not inserted). We supposed that it was related to problems with MS2 and PP7 purification and its compatibility with Gibson assembly reaction.
References
- Felletti, M. et al. 2016. Twister ribozymes as highly versatile expression platforms for artificial riboswitches; Nature Communications.
- Berry, K. E., Hochschild, A. 2018. A bacterial three-hybrid assay detects Escherichia coli Hfq-sRNA interactions in vivo. Nucleic Acids Research 46.
- SenGupta, D. J., Zhang, B., Kraemer, B., Pochart, P., Fields, S., and Wickens, M. 1996. A three-hybrid system to detect RNA-protein interactions in vivo. Proceedings of the National Academy of Sciences 93, 8496–8501.
- Dimitrova, M., Younès-Cauet, G., Oertel-Buchheit, P., Porte, D., Schnarr, M., and Granger-Schnarr, M. 1998. A new LexA-based genetic system for monitoring and analyzing protein heterodimerization in Escherichia coli. Molecular and General Genetics MGG 257, 205–212.
- Daines, D. A., Granger-Schnarr, M., Dimitrova, M., Silver, R. P. 2002. Use of LexA-based system to identify protein-protein interactions in vivo. Methods Enzymol 358:153–161.
- Daines, D. A., Silver, R. P. 2000. Evidence for multimerization of Neu proteins involved in polysialic acid synthesis in Escherichia coli K1 using improved LexA-based vectors. J Bacteriol 182:5267–5270.