Team:TUDelft/Design

Home

Project

Description Design Results Demonstrate

Wetlab

Experiment Protocols Safety Notebook

Modeling

Model

Reaction Kinetics

Copy Number independence Transcription Variation Translation Variation

Codon Harmonization

Parts

Parts Overview

Human Practices

Human Practices Education & Engagement

Team

Team Members Collaborations

Acknowledgements

Attributions Sponsors

Judging Form Medal Requirements

 

• The Sci-Phi 29 Universal Toolkit
• Orthogonal Replication
• Controllable Expression
• Modular Cloning

The Sci-Phi 29 Universal Toolkit

Inspired by iGEM’s great contribution in the creation and standardization of parts, our vision is to engineer a universal toolkit which can operate efficiently and predictably in any bacterial chassis (Adams, 2016). We envision that this will encourage iGEM teams and other synthetic biologists to use a wider range of organisms in their projects, saving time and resources in developing species-specific parts, consequently unifying the efforts of Synthetic Biology into host-independent genetic engineering (Kushwaha & Salis, 2015).

In order to create a transferable genetic toolkit, whose parts present predictable and standardized behavior across a wide range of bacteria, we have addressed the two main processes in molecular biology: replication of genetic vectors and gene expression. By applying the engineering concepts of orthogonality (Yang et al., 2018) and systems control (Ma et al., 2009), we aim to construct synthetic devices which decouple replication and gene expression levels from the varying conditions within different bacteria.

We thus have investigated the phi29 replication system (Blanco & Salas, 1985) for, in vivo, orthogonal replication to create a universal vector to replicate independently of the host’s replication machinery. We have also engineered an orthogonal incoherent feed-forward loop (iFFL) to achieve stabilization of expression levels across different bacterial species.

• Benefits of Orthogonality ﹀

  Much like how software developed for one operating system may fail to run in another operating system due to system-based specificities, genetic circuits seldom function effectively when transferred across two host organisms. Orthogonal systems are the “virtual machines” of Synthetic Biology: a network of processes which are insulated and independent from the host’s own native functions. Due to the minimal interactions between the orthogonal circuit and the rest of the cell, orthogonal systems can be highly predictable and transferable. These qualities make them very promising in universal expression tools. Furthermore, little effect on the host means these systems can be heavily engineered to exhibit new functions (Liu et al., 2018).

  
  
  

  
  Figure 1: phi29 orthogonal replication and T7 orthogonal transcription represented in our designed Sci-Phi 29 tool. Orthogonality allows these processes to be controlled independently of the host's own native processes, insulating the expression vector from species-specific nuances.

  
  

  Orthogonal DNA replication has been adapted from a natural cytoplasmic selfish plasmid of K. lactis and implemented in multiple species of yeast (Ravikumar et al., 2014). However, no orthogonal replication systems has been successfully engineered in bacteria (Ma et al., 2015). We believe that establishing orthogonal replication in prokaryotes would be truly beneficial to Synthetic Biology in order to create a universal genetic vector which is truly transferable across highly divergent species. The further engineering of such a system would benefit Synthetic Biology efforts of every bacterium it works in.

  
  

  Orthogonal transcription is ubiquitous in Synthetic Biology, most prominently with the T7 bacteriophage RNA polymerase (T7 RNAP) and its corresponding promoter and terminator. The T7 transcription system has been extensively explored for heterologous expression in a wide range of organisms, as well as applied in logic circuits and cell-free systems (Wang et al., 2018). The T7 promoters have also been used in universal expression tools, which allowed for effective expression in a diverse set of bacteria without the need for host-specific promoters (Kushwaha & Salis, 2015; Kar & Ellington, 2018; Liang et al., 2018). While systems rely on ribosome binding site (RBS) design for calibrating gene expression (Kushwaha & Salis, 2015; Liang, Li, Wang, & Li, 2018), Kar and Ellington demonstrated the use of different T7 promoter mutants with different strengths to regulate expression in a host-independent manner (Kar & Ellington 2018). However, these systems are still prone to variations in translation rate which, result from transferring the system between bacterial species, requiring constant recalibration for similar expression levels across organisms. To address this issue, we have designed a novel T7-based iFFL.

  
  

  Orthogonal translation can be separated into two processes. The first process is orthogonal translation initiation, which can be engineered with orthogonal 16s rRNA (o-ribosomes) and orthogonal RBS sequences (Darlington, Kim, Jiménez, & Bates, 2018). The second process is orthogonal translation elongation, which is related to codon usage. This process can be engineerd via orthogonal tRNA-amino acid synthetases and orthogonal tRNAs (Chin, 2014). Unfortunately, even orthogonal translation initiation, which is far simpler to engineer, is not appropriate for universal expression tools. This is because o-ribosomes and o-RBSs are designed by computationally predicting Shine-Dalgarno and anti-Shine-Dalgarno sequences, which have minimum cross-talk with the host’s translation machinery, making it necessary to re-design these tools for every new organism (Chubiz & Rao, 2008). Fortunately, with our designed incoherent feed-foward loop, it is possible to insulate expression levels from inter-species translational variations without the use of orthogonal translation.

  
  

Host Independent Replication

Mobile genetic elements will continue to be essential tools for Synthetic Biology: their flexible interchangeability across strains is crucial to reach a new multi-chassis genetic engineering paradigm (Jain & Srivastava, 2013).

One of the main constraints in genetically engineering novel and unconventional organisms is the need to identify vectors that work in these organisms. Natural broad host range plasmids can be replicated in a wider range of bacteria, but are often shown to be limited to specific groups of organisms, and their considerable size and complexity results in large fitness costs. Thus, substantial investigative efforts must be put in the determination of host range and reduction of fitness costs of these vectors (Shintani Masaki and Suzuki, 2019).

Our team sees the potential of orthogonal systems in overcoming these issues. We thus have taken a bottom-up approach in engineering an independent DNA replication system in live bacterial cells. We have turned to the B. subtilis double-stranded DNA bacteriophage known as phi29 (Blanco & Salas, 1985). A replication system such as the phi29 replication machinery can theoretically be applied to any bacterium species as well as any other organism, since it only requires the expression of its own replication machinery (Liu, Jewett, Chin, & Voigt, 2018).

The phi29 replication system has been shown to efficiently amplify DNA sequences by using only 4 relatively small proteins in synthetic liposome cells (Nies et al., 2018). The mechanisms of the system are explained in the video and text below (Blanco et al., 1994).

Video 1: The replication process begins with the binding of the phi29 DNAP and TP complex at both origins of replication (OriR and OriL), which flank the protein-primed linear plasmid. The DSB proteins aid in the process of replication and binds with a higher frequency at the origins of replication, destabilizing the region and facilitating strand displacement. The SSB proteins bind to the displaced DNA strand preventing strand switching of DNA polymerase and protecting the linear plasmid from host nucleases (Mencia et al., 2011).

The linear, double-stranded DNA is flanked by two origin of replication sequences, named OriL and OriR. The terminal protein (TP) is linked to the 5’ end of each strand by a amino acid/nucleotide covalent bond, which protects the DNA from exonucleases.

In initation, multiple double-stranded binding proteins (DSB) bind along the origin sequences, causing a conformation change in the DNA which allows opening of the DNA duplex. The TP, forming a heterodimer with the single-subunit DNA Polymerase (DNAP) acts as a primer by recognizing the origins of replication. DNAP then catalyzes a covalent bond between the hydroxyl group of amino acid Ser-232 of TP with an AMP molecule.

During elongation, DNAP dissociates from TP and replicates the DNA with high processivity, demonstrating helicase activity, causing strand displacement.Single-stranded binding proteins (SSB) bind to the newly displaced single-stranded DNA for stabilization. During DNA synthesis, DNAP displaces both DSB and SSB proteins form double-strands and previously displaced single strands, respectively. When polymerization is completed, the DNAP dissociates from the DNA resulting in termination.

Reaching out to experts in orthogonal replication, we have come to learn that overexpression of the 4 phi29 proteins would not be sufficient for establishing the system in vivo, due to possible unintended interaction of the proteins with the host’s DNA. We consequently set out to find optimal concentrations of these proteins in E. coli. Furthermore, we demonstrated cell-free replication of our constructed linear DNA sequences to assess the functionality of replication of the system when modified to our particular application.

• Benefits of the phi29 Replication System ﹀
  • With only 4 proteins and 2 replication origin sequences, the phi29 replication machinery is quite simple and presents less burden to the cells than many other replisomes (Nies et al., 2018).
  • phi29 is the most studied and understood double-stranded DNA bacteriophage (Blanco et al., 1994). The existing literature facilitates further engineering of our system in novel technologies.
  • The phi29 DNA Polymerase has high processivity and fidelity (Blanco & Salas, 1985).
  • The phi29 system has been demonstrated to be a powerful tool for synthetic cell studies (Nies et al. 2018). In vivo replication of the phi29 system can be better engineered based on knowledge obtained with cell-free assays. Furthermore, a system which is easily transferable between in vivo, and in vitro systems would be incredibly useful in many applications.
  • The protein primed DNA offers many possibilities to engineer the terminal proteins with functional peptide sequences (Gella, Salas, & Menci, 2016). We envision that the unique configuration of the double-stranded, protein-capped linear replicon will be a basis for many new engineered protein-DNA complexes.
  • Orthogonal replication not only enables replication independent from the host. It allows the ability to engineer the orthogonal DNA polymerase’s fidelity without introducing mutations in the cell’s genome, which makes in vivo directed evolution a possibility (Ravikumar et al., 2014).
  • The necessity of the 4 proteins for efficient DNA replication, as well as the TP-based DNA priming, make the phi29 system a viable option for a biologically contained system, contributing to the safety of its biotechnological applications (Torres et al., 2016).

iFFL to Control Gene Expression across Organisms

Whenever a new synthetic system is developed in a model organism like E. coli, its implementation in another bacterium often requires complete rewiring and retuning of parts that function analogously in the new organism. This incompatibility arises from interspecies variations (Adams, 2016), such as plasmid copy number (De Gelder et al., 2007), transcription rates of promoters (Meysman et al., 2014), translation initiation rates of ribosome binding sites (RBS) and the codon usage of coding sequences (Sharp et al., 2005).

Applying the concept of orthogonality, we approached the issue with the use of the T7 bacteriophage RNA polymerase (T7 RNAP), the most commonly used orthogonal transcription system. This system has been shown to enable host-independent transcription in a wide range of organisms (Wang, et al., 2018).

For host independent expression, we have investigated the implementation of autonomous T7 RNAP regulation in a portable expression system consisting of a Mixed Feedback Loop (MFL), known as Universal Bacterial Expression Resource (UBER) (Kushwaha & Salis, 2015). UBER and similar systems are quite powerful tools as they do not depend on host-specific transcriptional elements (Kushwaha & Salis, 2015; Kar & Ellington, 2018; Liang et al., 2018). However, UBER does not achieve reproducible expression levels across the organisms it is implemented in (demonstrated by the Rice iGEM team 2018). Furthermore, changes in translation rates of the genes occur when transferring the system between organisms.

• Portable Expression Tools﹀
  The MFL of the UBER circuit consists of a TetR repressor under a T7 promoter, regulating expression of T7 RNAP, under an engineered T7 promoter with TetO operators. While the self-transcribing T7 RNAP accumulates in a positive feedback loop, the accumulation of TetR represses T7 RNAP transcription in a negative feedback loop. Control of T7 RNAP levels prevents cytotoxicity caused by overexpression of the high-processivity protein (Dubendorfft & Studier, 1991).
  
  
  

  
  Figure 2: Mixed Feedback Loop circuit of the UBER portable expression tool. Calibration of T7 RNAP concentrations is performed by exchanging between computationally design RBSs. This calibration is thus host-specific.

  
  

  The levels of TetR and T7 RNAP are calibrated with the use of different computationally designed RBSs (Salis et al., 2009) in both genes, resulting in different levels of T7 RNAP transcription rates for each calibration (Kushwaha & Salis, 2015). Unfortunately, as is predicted in the RBS Calculator 2.0 (Salis et al., 2009), RBS strength is a species-specific parameter. Thus recalibration of both genes as well as the genes of interest becomes necessary when transferring genes across certain bacteria.

  
  

  Other portable expression systems partly overcome this issue: the use of antisense RNA for regulation of T7 RNAP removes the need to also calibrate the TetR RBS to achieve same levels of expression (Liang et al., 2018). The use of different T7 promoter mutant variants with different strengths allows the host-independent tuning of transcription of the gene of interest (Kar & Ellington, 2018). However, in these cases translation-based changes of expression will still occur in both the T7 RNAP and gene of interest levels. Therefore, in order to achieve gene expression levels independent of translational variations, we have designed a T7-transcribed iFFL loop with same RBS for the repressor and the gene of interest.

  
  

Further investigation of systems control engineering concepts has led us to the iFFL, a simple three-node network which was predicted to achieve robust adaptation to input variations (Ma et al., 2009).

Figure 3: The Incoherent feed-foward loop is a simple 3-variable network which provide robust adaptation of output due to compensation of the repressor.

As observed in Figure 3, whenever input goes up or down, the output changes along with it. However, we can add a repressor that is affected linearly with the input. When the input increases, the repressor rises similarly and the expected increase in the output is counteracted by higher inhibition. When the input decreases, the repressor is lowered, and the expected decrease in the output is compensated by lower repression.

Segall-Shapiro and colleagues have implemented this circuit in order to achieve gene expression independent of copy number, genomic location and growth rate. Adaptation to such variations can be achieved by regulation with a strong repressor with uncooperative binding such as TALE proteins (Segall-Shapiro et al., 2018).

Figure 4: Basic genetic circuitry of iFFL. A TALE protein serves as a uncooperative repressor for the gene of interest (GFP).

Any variation in plasmid copy number that would alter expression of the gene of interest also affects the repressor’s expression, which has an inverse effect on gene expression, thus compensating for that variation. This control only functions, of course, if both genes are on the same plasmid, thus being affected by changing copy number in the same way (if inhibition were not to occur).

• Benefits of TALE Proteins﹀

  Highly engineered transcription activator-like effector (TALE) proteins are comprised of intervals of repeated aminoacid sequences spaced by non-repeat sequences of two aminoacids. Each of the non-repeat pairs of the residue binds to specific nucleotides in DNA sequences. As a result, novel TALE proteins can be designed and constructed to bind to specific sequences of DNA, much like a protein-only version of CRISPR-Cas9 systems (Sakuma, et al., 2013).

  
  

  As predicted by modeling, to achieve stabilization from input variations, the repressor must bind non-cooperatively to the promoter. In other words, the level of the repressed promoter is linearly related to repressor concentration. TALE proteins are strong uncooperative repressors, thus being perfect candidates for iFFL stabilization.

  
  

  CRISPR-dCas9 can also be considered to have uncooperative binding: iGEM Thessaloniki 2018 successfully implemented it in a iFFL. However, we identified a main drawback which forbid the use of dCas9 for our application. dCas9 repression depend on expression levels of the protein as well as gRNA levels, both of which would vary in different organisms. This makes repression a non-linear function, that is, cooperative.

  
  

  Furthermore, another advantage of TALE proteins is the possibility to increase recognition sites to longer sequences. Longer recognition sites would be favorable in avoiding undesired off-target binding when the system is applied across organisms.

  
  

Through modeling predictions, we saw the opportunity to expand the control of gene expression to other factors that vary across organisms by modifying the system in multiple ways. In summary, we discovered that as long the ratio of expression levels between the (unrepressed) output gene and the repressor are kept the same between organisms, we can maintain control of the output gene.

Figure 5: Design of our orthogonal transcription iFFL for the stabilization of expression across organisms. T7 promoter variants ensure constant ratio of transcription in varying T7 RNAP concentrations and activity. The use of the same RBS in both repressor and output gene result constant ratio of translation initiation in both genes. This results in independence of gene expression levels from variations in these rates.

T7 promoter variants were used to drive transcription of both TALE and gene of interest in an orthogonal iFFL. By using our iFFL in expression strains (inducible T7 RNAP expression in their genome) or portable systems like UBER, we can implement the system across different species.

There are three key advantages of having an orthogonal iFFL. Firstly, we have predicted and experimentally verified that variations in T7 RNAP concentration will yield the same transcription of the gene of interest. Since the ratio of transcription between two T7 promoter variants is kept the same even across organisms, having the same percentage change in both repressor and output gene. Secondly, the ever-increasing library of T7 promoter variants allows for precise host-independent tuning of gene expression by exchanging T7 promoters of both repressor and output. Thirdly, we have demonstrated promoter strength independence of our iFFL by exchanging both promoter variants.

Furthermore, we have used the same RBS in both repressor and output gene in order to maintain the same ratio of translation initiation between these genes. The RBS calculator 2.0 predicts that RBS strength across species only changes due to differce in anti-Shine Dalgarno sequences, while other factors related to strength (such as mRNA secondary structures) do not change across bacteria (Salis et al., 2009). Consequently we can assume that: although the same RBS yields different translation initiation rates when combined with different genes, these translation initiation rates change in the same way when transferred between bacteria.

We constructed repressor and output gene (GFP) transcriptional units in an outward orientation (inverse from each other), reducing noise in GFP expression in response to readthrough transcription in terminators.

In our experiments, or constructs show independence of T7 RNAP concentration and promoter strength, as well as being compatible to portable systems such as UBER: a proof of the feasibility of portable T7 systems for controlled levels of expression across organisms.

We have also engineered a broad host range promoter version of our iFFL, since we considered that our system could also be useful for less explored organisms that may simply not be compatible with T7 RNAP or other orthogonal transcription systems (Zhao, et al., 2017). For this goal, we have designed broad host range promoters which allow for expression in a wide range of organisms (Yang, et al., 2018). This approach, although not as easily tunable as with T7 promoters (due to current limitations in promoter engineering), is certainly a more versatile version of our system with less moving parts (no addition of portable T7 tools), which could be applied in a straightforward manner when fine-tuning of gene expression is not as crucial. We have successfully implemented this system in both E. coli and P. putida, a first step to demonstrating control of expression levels across different organisms.

Figure 6: Broad host range promoter (Pbhr) version of the Sci-Phi 29 iFFL. The system is based in the assumption that the engineered promoters maintain a constant ratio of transcription across different bacteria.

We have demonstrated our orthogonal expression level control system to be compatible with both orthogonal T7 expression systems and heterologous expression strains. Furthermore, we successfully engineering a broad host range promoter version which exhibited stabilization between two organisms, opening the possibility of finer tuning and further implementation of this system across non-canonical organisms.

Modular Cloning of Host-Independent Systems

We share the belief with other iGEM teams that Golden Gate Cloning is currently the most flexible and convenient technique for standardization in Synthetic Biology. It enables parallel one-pot assembly of full transcriptional units while not requiring the ordering of primers, as parts are interchangeable and construction is highly modular. This type of assembly fits perfectly with our and many other iGEM projects, where a multitude of genetic circuits with single-part changes can be easily constructed, enabling high-throughput assembly and characterization of parts.

We have designed our collection of parts to be Type IIS compatible, and all our genetic circuits were assembled by using the original Modular Cloning Toolkit (Weber et al., 2011; Werner et al., 2012). Although this being an older method of Golden Gate cloning, it was a great choice for our project. The toolkit presents a large collection of plasmids which provides a lot of options for assembly of tailor-made genetic circuits. Furthermore, the platform is also quite useful in the construction of phi29 replisome-based plasmids with the one pot assembly of up to 7 transcriptional units at a time. However, Modular Cloning (MoClo) also allows for the easy exchange of our iFFL circuitry between different backbones with its designed DraIII restriction sites in order to test it in other organisms, besides presenting both ColEI and the RK2 origins of replication for cloning in a broad host range plasmid.

Figure 7: We utilized the MoClo Toolkit for fast assembly of multiple variations of constructs. We also included a novel basic part in the assembly strategy: ribozyme insulators remove extra mRNA sequences in order to decouple translation rates from genetic context.

Exploring multiple features of the MoClo Toolkit, we have developed a collection of essential parts for cloning of host-independent circuits. The collection consists of 21 novel parts, with 4 T7 promoter variants, 4 broad host range promoters, 7 ribozyme-based insulator and 5’ UTR parts, 5 coding sequences, 1 terminator, and 2 linear plasmid origin sequences, as well as using multiple parts already in the registry. Although the collection may not be extensive, our project was designed to allow quick expansion of our parts.

• Design of our Part Collection﹀

  Although there are many efforts to develop T7 promoter variants, we have chosen to obtain our promoters from the work of Komura and colleagues (Komura et al., 2018). Through a high-throughput biased randomization and screening via barcoding, 7847 promoter variants were quantified for transcription rates. If we can validate screening methods such as this in vivo, we would be able to fine-tune our system with thousands of options without the need of previous characterization. We therefore encourage future efforts to explore this enormous library of T7 promoters for its further validation.

  
  

  To engineer our T7 promoter variants with the TALE protein operator, we have added the sequence directly downstream of the sequence. Results show repression was successful with this design.

  
  
  
  

  
  Figure 8: Design of TALEsp1-regulated version of T7 promoter variants was done by annexing the operator sequence directly downstream of the 23 base pair promoter.

  
  

  Broad host range promoters (Pbhr) were adapted from an engineered promoter which exhibited effective expression in E. coli, B. subtilis and S. cerevisiae. For our application in bacteria, we have removed the sequence related to eukaryotic expression. We further engineered the promoters by inserting the TALE operator sequences between the promoter’s -35 and -10 conserved regions (essential to expression in prokaryotes) (Yang, et al., 2018).

  
  
  

  
  Figure 9: Design of TALEsp1-regulated versions of broad host range promoters (Pbhr) was done by introducing the operator sequence within the -35 and -10 highly conserved regions.

  
  

  For 5' UTR parts, we have developed a modular cloning technique for assembling different ribozymes with different RBS sequences. With that in mind, our technique could be expanded to have all 10 ribozyme insulators previously identified (Lou et al., 2012). As for RBS sequences, we wish to calibrate our iFFL systems to express TALE repressors in lower rates, for example. For this, one could use the RBS calculator (Salis et al., 2009) to design 5' UTR parts with same the anti-Shine Dalgarno sequence but changing additional nucleotides in order to tune translation rates of the different proteins while maintaining independence of translation initiation across organisms.

  
  

  We expect the phi29 proteins to be kept constant during the further advancement of our universal toolkit. However, we have developed a computational tool in order to engineer coding sequences to present reduced variations of codon usage across a determined group of organisms. We also expect that new TALE proteins optimized for large groups of bacteria should be designed to improve the applicability of the platform.

  
  

  In order to avoid homologous recombination, we have obtained a variant of the T7 terminator. The effort of developing these alternative terminator has yielded 8 different sequences (Temme et al., 2012). Different terminator efficiencies can help regulate multiple genes in the appropriate ratios. Terminators with higher efficiency can also be included in the platform for better insulation of the transcriptional units.

  
  

We have expanded Golden Gate assembly in two ways: the modular construction of 5’ UTR parts by combining different ribozyme-based insulators and ribosome binding sites; and a method to make the two most used Golden Gate strategies compatible. With these novel techniques, we have done our part in expanding the usefulness, customizability and interchangeability of the Golden Gate strategies for further use by synthetic biologists.

• Modular Assembly of Ribozymes and RBS parts﹀

  To characterize a Biobrick in a single construct and being able to predict its behavior in combination with other parts is the basis of Synthetic Biology. Unfortunately, in practice, genetic circuits often behave unpredictably when implemented in response to different genetic contexts, which limits the field as an engineering discipline. For example, engineered promoter parts may contain operator sequences downstream of the transcription start site. Additionally, constructs assembled with Golden Gate cloning present the fusion site’s 4 extra base pairs (TACT) between the promoter and 5’ UTR. Although it would be ideal that the operator does not affect expression rates, the additional transcribed sequence may affect mRNA secondary structures and drastically change translation rates (Salis et al., 2009).

  
  

  To ensure predictability and modularity when exchanging between promoters and 5’ UTR parts, ribozyme-based insulators can be used. The self-cleaving ribozymes remove the 5’ region from mRNA, while 3’ hairpin loops form in the uncut sequence of the insulator extra base pairs. Lou and colleagues have (Lou et al., 2012) mined and engineered 10 ribozyme-based insulators. The use of different insulators for each transcriptional unit in multigene constructs is necessary to avoid homologous recombination.

  
  

  Once we have engineered operators downstream of T7 promoters and compared them with the original sequences, we were sure ribozyme insulators were essential for our experiments. However, due to our use of same RBS sequences in our stabilization system, this would mean we would need to have long ribozyme+RBS parts synthesized, redundantly ordering all the possible combinations of ribozyme and RBS we wished to use.

  
  

  Therefore, we have developed a method for Golden Gate cloning of ribozymes and 5' UTR combinations. By identifying an adequate 4 base pair sequence in the conserved 3' hairpin loop region (ACCTCTACAAATAATTTTGTTTAA) of the insulators, we have designed a fusion site (GTTT) for scarless Golden Gate assembly of these two types of parts. By performing scarless construction, we overcome the issue of fusion site scars affecting mRNA function.

  
  
  
  
  Figure 10: Modular assembly of insulated 5' UTR with the combination of ribozyme insulator parts and RBS parts for precise expression of multigene constructs.
  
  

  Besides using the GTTT fusion site downstream of the ribozyme part and upstream of the 5’ UTR part, only one small modification in the sequences is necessary in this method: In order to achieve scarless assembly, the two last AA nucleotides of the ribozyme were left out from the sequence. Therefore, the compatible RBS parts require the addition of AA upstream of the sequence in order to complete the insulator sequence.

  
  

• Golden Gate Conversion Method﹀

  Although, traditionally, Golden Gate cloning consists of 4 inserts (promoter, 5’ UTR, coding sequence, terminator) and a backbone (Weber et al., 2011), there are many powerful strategies of Golden Gate cloning, each with their own advantages. For example, the MoClo Yeast Toolkit, a very prominent platform for cloning of S. cerevisiae shuttle vectors, introduced the use of connectors as well as origin of replication and antibiotic resistance parts (Lee et al., 2015). The 2018 Marburg team has adapted the strategy to create their own Golden Gate toolkit for the fast-growing V. natriegens. This year’s team has expanded the Marburg Collection with the creation of parts for cloning of the cyanobacteria S. elongatus. The strategy allows the user to choose origins of replication and antibiotic resistance genes according to the organism that will be engineered.

  
  

  Our project has unique considerations when using Golden Gate cloning: as our final goal is a host-independent cloning, we hope to, in the future, develop a single shuttle vector backbone, with optimized expression of both orthogonal transcription and replication machinery as well as the repressor for the iFFL. However, in order to test our expression system separately in multiple organisms, we needed to transfer our host-independent constructs across different backbones.

  
  

  In order to construct a new entry vector, we have designed primers to amplify any single gene or multigene constructs or a color marker of the Moclo Toolkit, adding extra ends with Type IIS restriction sites. By using pre-existing connector, origin and antibiotic resistance parts, or by amplifying a backbone to have the same Type IIS fusion sites, we can assemble any type entry vector, specialized for any organism we wish to test our host-independent expression systems in.

  
  
  
  
  Figure 11: Amplification of entry site of MoClo plasmid with our designed primers or assembled color output transcriptional unit, followed by Golden Gate assembly with plasmid backbone parts allows for the construction of customized MoClo entry vectors, applicable to different bacterial species.
  
  

  Furthermore, we can also explore the built-in DraIII fusion sites present in every MoClo plasmid. After construction of a host-independent composite part, we can easily transfer it into any of the preassembled backbones by performing a DraIII restriction ligation reaction with excess of the insert.

  
  
  
  
  Figure 12: DraIII restriction-ligation reactions allow for easy reversible exchange of MoClo-assembled host-independent circuits across different plasmid backbones.
  
  

  We have validated the approach experimentally by transferring our constructs to a broad host range plasmid backbone which allow expression in P. putida.
  
  

References

• Adams, B. (2016). The Next Generation of Synthetic Biology Chassis: Moving Synthetic Biology from the Laboratory to the Field. ACS Synthetic Biology, 5(12), 1328-1330.
• Blanco, L., & Salas, M. (1985). Replication of phage phi29 DNA with purified terminal protein and DNA polymerase: Synthesis of full-length 429 DNA (protein-primed initiation/phage 429 DNA polymerase/phage 429 terminal protein).
• Blanco, L., Lazaro, J., De Vega, M., Bonnin, A., & Salast, M. (1994). Terminal protein-primed DNA amplification.
• Chin, J. (2014). Expanding and Reprogramming the Genetic Code of Cells and Animals. Annual Review of Biochemistry, 83(1), 379-408.
• Chubiz, L., & Rao, C. (2008, 7). Computational design of orthogonal ribosomes. Nucleic Acids Research, 36(12), 4038-4046.
• Darlington, A., Kim, J., Jiménez, J., & Bates, D. (2018, 12 1). Dynamic allocation of orthogonal ribosomes facilitates uncoupling of co-expressed genes. Nature Communications, 9(1)
• Dubendorfft, J., & Studier, F. (1991). Controlling Basal Expression in an Inducible T7 Expression System by Blocking the Target T7 Promoter with Zac Repressor.
• De Gelder, L., Ponciano, J., Joyce, P., & Top, E. (2007, 2). Stability of a promiscuous plasmid in different hosts: No guarantee for a long-term relationship. Microbiology, 153(2), 452-463.
• Gella, P., Salas, M., & Mencía, M. (2016). Engineering Permissive Insertion Sites in the Bacteriophage Phi29 DNA-Linked Terminal Protein. Plos One, 11(10).
• Jain, A., & Srivastava, P. (2013, 11). Broad host range plasmids. FEMS Microbiology Letters, 348(2), 87-96.
• Kar, S., & Ellington, A. (2018). Construction of synthetic T7 RNA polymerase expression systems. Methods, 143, 110-120.
• Komura, R., Aoki, W., Motone, K., Satomura, A., & Ueda, M. (2018). High-throughput evaluation of T7 promoter variants using biased randomization and DNA barcoding. Plos One, 13(5).
• Kushwaha, M., & Salis, H. (2015). A portable expression resource for engineering cross-species genetic circuits and pathways. Nature Communications, 6, 1-11.
• Lee, M., DeLoache, W., Cervantes, B., & Dueber, J. (2015, 9 18). A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly. ACS Synthetic Biology, 4(9), 975-986.
• Liang, X., Li, C., Wang, W., & Li, Q. (2018, 5 18). Integrating T7 RNA Polymerase and Its Cognate Transcriptional Units for a Host-Independent and Stable Expression System in Single Plasmid. ACS Synthetic Biology, 7(5), 1424-1435.
• Liu, C., Jewett, M., Chin, J., & Voigt, C. (2018). Toward an orthogonal central dogma. Nature Chemical Biology, 14(2), 103-106.
• Lou, C., Stanton, B., Chen, Y., Munsky, B., & Voigt, C. (2012, 11). Ribozyme-based insulator parts buffer synthetic circuits from genetic context. Nature Biotechnology, 30(11), 1137-1142.
• Ma, W., Trusina, A., El-Samad, H., Lim, W., & Tang, C. (2009, 8 21). Defining Network Topologies that Can Achieve Biochemical Adaptation. Cell, 138(4), 760-773.
• Ma, W., Phan, A., Walsh, R., & Ye, K. (2015). Building an Orthogonal Replication Systems for Performing Directed Evolution in Escherichia coli: A Strategic Review and a Summary of the Initial Steps in Cloning Bacteriophage T7 gp4 Primase/Helicase. JEMI.
• Mencía, M., Gella, P., Camacho, A., de Vega, M., & Salas, M. (2011). Terminal protein-primed amplification of heterologous DNA with a minimal replication system based on phage Phi29. Proceedings of the National Academy of Sciences of the United States of America, 108(46)
• Meysman, P., Collado-Vides, J., Morett, E., Viola, R., Engelen, K., & Laukens, K. (2014, 2 7). Structural properties of prokaryotic promoter regions correlate with functional features. PLoS ONE, 9(2).
• Nies, P., Westerlaken, I., Blanken, D., Salas, M., Mencía, M., & Danelon, C. (n.d.). Self-replication of DNA by its encoded proteins in liposome-based synthetic cells. Nature Communications(2018), 1-12.
• Omotajo, D., Tate, T., Cho, H., & Choudhary, M. (2015, 8 14). Distribution and diversity of ribosome binding sites in prokaryotic genomes. BMC Genomics, 16(1).
• Ravikumar, A., Arrieta, A., & Liu, C. (2014). An orthogonal DNA replication system in yeast. Nature Chemical Biology, 10(3), 175-177.
• Salis, H., Mirsky, E., & Voigt, C. (2009, 10). Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology, 27(10), 946-950.
• Sakuma, T., Ochiai, H., Kaneko, T., Mashimo, T., Tokumasu, D., Sakane, Y., . . . Yamamoto, T. (2013, 11 29). Repeating pattern of non-RVD variations in DNA-binding modules enhances TALEN activity. Scientific Reports, 3.
• Segall-Shapiro, T., Sontag, E., & Voigt, C. (2018). Engineered promoters enable constant gene expression at any copy number in bacteria. Nature Biotechnology, 36(4), 352-358.
• Sharp, P., Bailes, E., Grocock, R., Peden, J., & Sockett, R. (2005). Variation in the strength of selected codon usage bias among bacteria. Nucleic Acids Research, 33(4), 1141-1153.
• Shintani Masaki and Suzuki, H. (2019). DNA Traffic in the Environment (pp. 109-133). Singapore: Springer Singapore.
• Temme, K., Hill, R., Segall-Shapiro, T. H., Moser, F., & Voigt, C. A. (2012). Modular control of multiple pathways using engineered orthogonal T7 polymerases. Nucleic Acids Research, 40(17), 8773–8781.
• Torres, L., Krüger, A., Csibra, E., Gianni, E., & Pinheiro, V. B. (2016). Synthetic biology approaches to biological containment: pre-emptively tackling potential risks. Essays in Biochemistry, 60(4), 393–410.
• Wang, W., Li, Y., Wang, Y., Shi, C., Li, C., Li, Q., & Linhardt, R. (2018). Bacteriophage T7 transcription system: an enabling tool in synthetic biology. Biotechnology Advances, 36(8), 2129-2137.
• Weber, E., Engler, C., Gruetzner, R., Werner, S., & Marillonnet, S. (2011). A modular cloning system for standardized assembly of multigene constructs. PLoS ONE, 6(2).
• Werner, S., Engler, C., Weber, E., Gruetzner, R., & Marillonnet, S. (2012). Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs, 3(1), 38-43.
• Yang, S., Liu, Q., Zhang, Y., Du, G., Chen, J., & Kang, Z. (2018). Construction and Characterization of Broad-Spectrum Promoters for Synthetic Biology.
• Zhao, H., Zhang, H., Chen, X., Li, T., Wu, Q., Ouyang, Q., & Chen, G. (2017). Novel T7-like expression systems used for Halomonas. Metabolic Engineering, 39(October 2016), 128-140.

Special thanks to our sponsors