Inital tests
Goal
This section aims to do all of the tests and measurements necessary before beginning to work with our biological and non-biological material.
Principle
The ability of bacteria to grow on the different medium and the absence of contamination is determined by solid and liquid culture of each strain on the different growth medium. Concentration of compounds of interest in sludges are also measured by using appropriate technics. Heavy metal concentrations are measured by ICP, glucose by DNS methode and ethanol, by densimeter.
Material & methods
Strain growth
Cupriavudus metallidurans CH34 and E. coli S17-1 are plated on Browth Medium 3 (BM3) and 284 Medium then incubated for 1day (E. coli) or three days (C. metalidurans). the number of colonies on the plates is then counted. Bacteria are the inculated in BM3 and 284, and the OD660 is measured at t=0, t=1 and t=3 days. For both plate and liquid culture, a negative control without bacteria is also carried out.Stock glycerols have also been produced to preserve the strains used.
Sample collection:
Take 200µL of culture medium (white) or bacterial culture and place them in a spectrometric tank.
Add 800mL of water
Reading of the optical density:
Read the optical density at 600 nm using a spectrophotometer
Final glycerol concentration is recommended to be 15%, so for a final volume of 1 mL it is necessary to add 250 µL of stock glycerol 60%
1. Put 750 µl of the cell culture into an Eppendorf tube and add 250 µl of 60% Glycerol. Vortex the mix.
2. Store in the -80ºC freezer
Sludge drying :
Sludges is consisted of water and dry matter. Dryness is the mass percentage of dry matter.
Dryness is assessed by the amount of solid remaining after heating to 105°C over night. It is expressed as a percentage by weight.
The dryness is dertermined by the the following equation :
Sludge heavy metal concentration measurement
Sewage sludges are dryed at 105°C. 200mg of dried sudge is put in specific acid volume for the mineralisation. Finally the samples are dilutes in QSP 50 ml of distilled water before vaccum filtration. The quantity of heavy metal is measured by ICP then reported to the dry mass of sludge.
Mineralization :
Dry the samples in an oven (100°C).
Take 200mg of dry matter and put them in teflon tubes.
Add 6mL of HNO3 and 3mL of HCL to each sample tube.
Place the tubes in the digestion chamber and carry out a heating cycle (heating up to 160°C for 15 minutes, then stabilize at this temperature for 40 minutes, and finally the cooling phase at 55°C for 15 minutes).
The samples are then placed in 50mL tubes (QSP 50mL H2O).
Filter the samples using a vacuum pump and nitrocellulose filters (0.45µm pore).
Store in a cold room until the samples pass through the ICP.
ICP (Inductively Coupled Plasma Spectrometry):
Place 5mL of each previously mineralized sample in the machine.
Start the machine with standard range with a mixed solution of lead and cadmium.
Make the measurement and report the data on the dry mass of sludge.
Heavy metal resistance modification
Goal
The main objective is to strategically remove heavy metal resistance genes of C. Metallidurans to specialize it or improve their aggregation of heavy metals.
More precise:
- Improve aggregation of Cadmium by removing czcD gene
- Decline aggregation of Cadmium (and specialize itself for others heavy metals) by removing czcA gene
- Decline aggregation of Lead (and specialize itself for others heavy metals) by removing PbrR and/or PbrT
Principle
The principle is to use the vector pCM184 with target gene’s borders to replace it, by homologous recombination, with a selection gene (Kanamycine resistance), then see if the gene deletion has an effect on resistance of others heavy metals.
For more details, see Design.
Material & methods
Target gene borders PCR amplification :
A genenomic purification (using the GeneJET Genomic purification Kit from Thermofisher Scientific) is realized on a Cupriavidus metallidurans CH34 Culture.
Each borders are amplify by PCR, using a pair of specific primers (see primers table)
Plasmid construction for homologous recombination using pCM184 :
pCM184 (from addgene) plasmid and upstream target gene border are both degested by BglII and NdeI restriction FastDigest enzymes (thermofisher scientific) then - after a verification of the digestion success by electrophoresis- the insert is ligated into pCM184 and the resulting plasmid is transformed and amplificated in Escherichia coli DH5alpha by chemical transformation. To check the ligation success, a colony PCR is realized over plasmid minipreparation (using the GeneJET Plasmid Miniprep Kit from Thermofisher Scientific) from the transformed E. coli which are positive to the colony PCR. These manipulations are repeated for downstream target gene border to obtain the functionnal Homologeous recombination plasmid.
Preparations of competent bacteria (for freezing)
The day before, take a colony of E. coli, inoculate 2 to 5ml of LB and incubate at 37°C overnight while shaking. Autoclave 100ml of LB (500ml erlen)
1. Take 1ml from the preculture to inoculate the 100ml of LB.
2. Incubate at 37°C (stirring), and check the DO600 (from 2 to 4 hours depending on the strains)
3. When the DO600 reaches 0.5, centrifuge the culture in 3 sterile 50ml Falcons (5 min, 4000 g, 4°C). Remove the supernatant.
4. Gently resuspend the bacterial pellets in 30ml (10ml per tube) of cold TFB1, collect the resuspensions in 1 tube, and leave the tube in the ice for 1h30.
5. Centrifuge the tube (5min, 4000g, 4°C) and remove the supernatant.
6. Resuspend gently in 3ml of cold TFB2, and aliquot in sterile microtubes (100 µl).
7. Freeze the microtubes at -80°C
Processing of competent bacteria (frozen)
1. Thaw the competent bacteria on the ice (50µl of bacteria = 1 transformation).
2. Switch on the water bath at 42°C.
3. Add to the 50µl of competent bacteria (in the ice) the plasmid to be transformed (previously cooled in the ice):
- 50 to 100 ng of pure plasmid
- 5 µl of ligation product
4. Mix gently by turning and leave in the ice for 20 minutes
5. Put the microtubes at 42°C for exactly 90 seconds.
6. Put the tubes back in the ice for 2-3 minutes, then add 450µl of LB
7. Grow at 37°C by shaking the tubes for 45min at 1h
8. Spread on a box (LB-Agar + antibiotic) with glass beads
- 50µl if transformation by pure plasmid
- 200 to 250µl if processed by ligation product
9. Leave the boxes (agar at the top) in the oven at 37°C for one night.
Tampon TBF1 :
100mM RbCl, 50mM MnCl2, 30mM KAcO, 10mM CaCl2, 15% glycerol
Tamponner à pH 5,8
Filtrer sur 0.22µ - garder à 4°C
Tampon TBF2 :
10mM MOPS, 10mM RbCl, 75mM CaCl2, 15% glycerol
Tamponner à pH 6,8
Filtrer sur 0.22µ - garder à 4°C
Preparation of the solution:
In PCR tubes make the following solution:
- 10 µL of green taq master mix kit (thermo scientific)
- 6 µL of water
- 2 µL of Forward primer (10mM)
- 2 µL of Reverse primer (10mM)
Colony sampling:
Sterile, remove a colony transformed with a cone.
Soak this cone in the previously made colony PCR solution.
Place this cone in a sterile culture tube and store it in the refrigerator.
Revelation of positive colonies:
Place the PCR tubes on colony in a thermal cycler and use the program provided by the green taq master mix kit (thermo scientific)
Then migrate the PCR product (agarose gel 1%) by electrophoresis
Select the positive colonies according to the electrophoresis strips (of the expected size) and add 5mL of culture medium with antibiotic to the culture tubes containing the corresponding colonies collected.
Homologous recombination
To achieve the transformation of Cupriavidus metallidurans CH34 by the plasmid containing the homology sequences to the genes targeted for homologous recombination, the conjugation transfer method was performed. The Cupriavidus metallidurans CH34 strain and Escherichia coli S17-1 bearing the pCM184 derivated plasmid are both grown over-night in BM3 at 30°C. Bacterias are then, whased and concentrated (by centrifugation) in NaCl 0.9% three times. The cell pellet is mixed in even quantities then after 5 minutes, a drop of the mix is dropped on a BM3 plate then incubated for 5 days at 30°C. the bacteria thus obtained are resuspended in 0.9% NaCl, shaked for 10 minutes, then inoculated at different concentration in 284 medium with kanamycin for selection of C. metallidurans recombinants.
Mutants functionnality tests
Recombinants and wild type C. metallidurans are inoculated into 284 medium and grown for 2 days. A negative control is realized without inoculation (equivalent volume of sterile milliQ mater is added). A t=0, t=1day and t=2days, a sample is collected in each tube. bacteria are separated from the remaining and the concentration in heavy metal in both bacterial and non-bacterial fractions are measured by ICP. The bacteria quantity in each tube is evaluated by plating a sample on BM3.
Ethanol metabolism implementation
Goal
The objective is to provide to our C. metallidurans strain, alcoholic fermentation genes (pyruvate decarboxylase and pyruvate deshydrogenase of Zymomonas mobilis) to permit it to produce ethanol from glucose.
To do this, we use the fusion protein of BBa_K1122673 part (Edingurgh 2013 team) under Pan promoter control (ref parts : pan + composite), to obtain strong expression, in particular in presence of heavy metals.
We have made an expression plasmid construction by inserting in vector pBBR2MCS-1, for expression at C. Metallidurans, the Pan promoter and the fusion protein ORF of the part BBa_K1122673.
Then, C. Metallidurans is transformed with this construction by electroporation.
Principle
On construit un plasmide d'expression en insérant dans le vecteur d'expression pBBR2MCS-1 pour une expression chez métallidurans le promoteur pan et l'ORF de la protéine fusion XXX. On transforme ensuite CH34 par ce plamide par éléctroporation.
Material & methods
Expression vector construction
the pBBR1MCS-2is and the BBa_K1122673 part are digested by EcoR1 and Spa1 Fast digest restriction enzymes (Thermofisher Scientific). After purification by GeneJET Gel Extraction and DNA Cleanup Micro Kit (Thermo fisher) and checking the digestion success by electrophoresis, the BBa_K1122673 ORF insert is ligated into pBBR1MCS-2 and the resulting plasmid is transformed into Escherichia coli DH5alpha. The ligation success is verified by realizing a colony PCR. The Pan promoter is digested and inserted into pBBRMCS- BBa_K1122673 by following the same process than for BBa_K1122673, with HindIII and EcoR1 Fast digest restriction enzymes (Thermofisher Scientific).
CH34 electroporation transformation
C. Metallidurans CH34 is grown overnight in BM3, then diluted in a bigger volume of BM3 and re-incubated at 30°C for 2 days. Cells are then cooled in ice for 20minutes, centrifugated (15 minutes at 4000g) and resuspended into washing buffer (compsition - see table). the centrifugation and resuspension in washing buffer is repeated 3 times. The last re-suspension volume is calculated to obtain an optical density of 120 at 660nm. the bacteria are aliquoted and 4µL of the plasmid solution (100ng/4µL) are added to the samples to be measured. Samples are incubated 1 minute in ice before being transferred in cooled electroporator cuve and placed into the electroporator. After the electroporation, 1ml SOC medium is added immediately to the bacterias. Suspension is transferred in tubes and incubated at 30°C for 1h, then plated on selective medium ().
Functionality test on recombinant cells for the ethanol production
To get cellulose, cleaning paper is blended in water. First, a digestion test of the paper mixed by cellulases from Trichoderma reesei is performed by adding 125 U of cellulases to 300mg of paper and incubated for 24 hours at 37°C. The results are observed through the disappearance of paper aggregates.
Then, 1,2g of mixed paper is added to 250mL of 284 medium in presence of cellulase. The Other conditions are the direct presence of glucose in medium 284 (instead of gluconate), a rich medium (BM3), and autoclaved or non-supplemented sewage sludge.
pBBR1MCS-2-pan- BBa_K1122673 transformed C. metallidurans or CH34 are inoculated in the different conditions (using a BM3 preculture) in presence of cellulase or not, then the glucose and ethanol concentrations are measured from T=0h at T=26h by using DNS method for the glucose and densimeter method for the ethanol. Negatives control without bacteria is also carried out.
Prepare the following DNS solution:
- 3,5-DNS 1% : 10g/L
- NaOH 0.4M : 16g/L
- Double tartrate (Na;K).4H2O 30%: 300g/L
Heat the solution to dissolve it at 90°C in a bain-mari.
Adjust the volume after heating with water.
Realization of a calibration range:
Achieve a glucose concentration range of 0 to 10 mM (including the expected concentration range in the samples).
Add to 100µL of each glucose solution of known concentration, 200µL of DNS solution.
Heat to 95°C for exactly 5 minutes.
Allow to cool and then deposit 200µL of each sample on a 96-well plate.
Sample production:
For each sample, add 600µL of DNS solution to 300µL of sample and heat to 95°C for exactly 5 minutes.
Allow samples to return to room temperature.
Place 200µL of each sample in triplicate in the 96-well plate.
Determination of glucose concentration:
Read the absorbance at 530nm of the standard range and of each sample (in triplicates).
Make a calibration curve of the absorbance as a function of the known glucose concentrations.
Report the absorbance values at 530nm of the samples on the calibration curve and deduce their glucose concentration
Final tests
Goal
The final tests confirmed the functionality of the project, that is to say, that Cupriavidus metalidurans has been modified by homologous recombination and is able to better or more specifically remove heavy metals from sludge, and that it is able to produce ethanol in sludge from glucose, obtained by digesting cellulose naturally present in sludge by cellulases.
Comparisons were made between C. metallidurans delaPbrR, CH34 and E. Coli S17-1 (negative control) strains for their heavy metal depollution capacity.
A comparison was also made between cultures grown in autoclaved or non-autoclaved sludge.
For these tests, several types of cultures are carried out.
The three strains are first put in the presence of Lead and Cadmium, in order to activate the resistance mechanisms to heavy metals.
These three strains are then cultivated in autoclaved or non-autoclaved sludge for 20 hours at 30°C.
An ICP analysis is performed, before and after culture, under the different culture conditions as well as on the bacteria alone (separated from the sludge).
Principle
Heavy metal depolluting test on the different strains cells : The three strains C. metalidurans CH34, C. metalidurans ΔPbrR and E. Coli S17-1 are initially seeded in BM3 and incubated at 30°C for 2 days to achieve preculture.
Each strain is then centrifuged and resuspended in medium 284 supplemented with lead (0.4mM) and cadmium (2mM) and incubated for 15 mins at 30°C.
This incubation allows the activation and implementation of the resistance mechanisms of C. metalidurans, so that they are already expressed during the culture in the sludge.
The concentrations of these metals have been chosen in such a way that they are just below the lethal concentrations.
After activation, the three strains are centrifuged and then resuspended under two culture conditions. The first is a culture in non-autoclaved sewage sludge, supplemented with BM3 (50/50, v/v). The second condition is a culture in autoclaved sewage sludge, supplemented with BM3 (50/50, v/v).
Growth monitoring was carried out in each culture condition, by measuring optical density at 600nm and spreading diluted samples by a factor of 102 and 106 on solid BM3 medium in order to count the bacteria.
After 20 hours of incubation, the different cultures were centrifuged, first at 300g for 5 minutes to recover the solid matter without bacteria contained in the sludge, then at 14000g for 5 minutes to recover the bacteria from each condition.
The solid matter, the bacterial pellet and the supernatant from the 14000g centrifugation were used to perform an analysis of the quantities of lead and cadmium by ICP.
The same manipulations were also carried out on mud samples supplemented with BM3, which were not sown with bacteria.
Material & methods
The three strains C. metalidurans CH34, C. metalidurans ΔPbrR and E. Coli S17-1 are initially seeded in BM3 and incubated at 30°C for 2 days to achieve preculture.
Each strain is then centrifuged and resuspended in medium 284 supplemented with lead (0.4mM) and cadmium (2mM) and incubated for 15 mins at 30°C.
This incubation allows the activation and implementation of the resistance mechanisms of C. metalidurans, so that they are already expressed during the culture in the sludge.
The concentrations of these metals have been chosen in such a way that they are just below the lethal concentrations.
After activation, the three strains are centrifuged and then resuspended under two culture conditions. The first is a culture in non-autoclaved sewage sludge, supplemented with BM3 (50/50, v/v). The second condition is a culture in autoclaved sewage sludge, supplemented with BM3 (50/50, v/v).
Growth monitoring was carried out in each culture condition, by measuring optical density at 600nm and spreading diluted samples by a factor of 102 and 106 on solid BM3 medium in order to count the bacteria.
After 20 hours of incubation, the different cultures were centrifuged, first at 300g for 5 minutes to recover the solid matter without bacteria contained in the sludge, then at 14000g for 5 minutes to recover the bacteria from each condition.
The solid matter, the bacterial pellet and the supernatant from the 14000g centrifugation were used to perform an analysis of the quantities of lead and cadmium by ICP.
The same manipulations were also carried out on mud samples supplemented with BM3, which were not sown with bacteria.
Primer table
Here are documented all the primer pairs we used in our experiments.
In the table, each pair is composed of two successive primers. the forward primer (first one in the table order) have is name ended by "_fwd" as the reverse primer has a name ended by "_rev".
The 8 first pairs correspond to the primer used for Cupriavidus metallidurans CH34 gene border amplification in perspective of homologous recombination. For all of these plasmids name is composed as follow :
"target gene name - side of the gene -(5 for upstream and 3 for downstream) _ orientation of the primer (forward or reverse)". The primer whom the name begins by Col is used in colony PCR, and the couple Cre157_fwd - Cre157_rev is designed to amplify Cre fragment from pCM157.
name
sequence
size
CzcD-5_fwd
AAAAGATCTGGTGCTGATGACGGCCCTGG
29nt
CzcD-5_rev
AAACATATGCCTGCGCCCATAGAAACTCC
29nt
CzcD-3_fwd
AAAGGGCCCCAGGAGGAAACTAAGGTGCG
29nt
CzcD-3_rev
AAAGTTAACAATCGTCTGCCCCCAACTCG
29nt
PbrR-5_fwd
AAAAGATCTTAACGGCTAGCGTTCGCTGC
29nt
PbrR-5_rev
AAACATATGTCATGGCGTCGGATGGGAGA
29nt
PbrR-3_fwd
AAAGGGCCCCCCATCCAAGCGACTAGGTG
29nt
PbrR-3_rev
AAAGTTAACCGACGTGGCCATCCTTGACG
29nt
PbrT-5_fwd
AAAAGATCTATGAGCACATCCGTCAGGTC
29nt
PbrT-5_rev
AAACATATGGCATGGGAGGCCTTACC
26nt
PbrT-3_fwd
AAAGGGCCCGGCCATCTACCCAGGTGTAA
29nt
PbrT-3_rev
AAAGTTAACGGATCTGGCATAACGTGGTG
26nt
CzcA-5_fwd
AAAAGATCTGGCTTGGCGACCGGGTC
26nt
CzcA-5_rev
AAACATATGACATTGCTGTTTCCCCCGTA
29nt
CzcA-3_fwd
AAAGGGCCCAAGGCCGCCAGCCTGC
25nt
CzcA-3_rev
AAAGTTAACGCCAAATGTCCGCTTCTTGT
29nt
Col-5_fwd
CATTTCCCCGAAAAGTGCC
19nt
Col-5_rev
AGATTTTGAGACACAACGTGG
21nt
Col-3_fwd
ACACCTTCTTCACGAGGCAGAC
22nt
Col-3_rev
ACAATCACGAAACGCGGCAG
20nt
Col-pBBR_fwd
GTTGGGTAACGCCAGGGT
18nt
Col-pBBR_rev
ACACAGGAAACAGCTATGAC
20nt
Col-Cre_fwd
TTTTCAATATTATTGAAGCATTTATCAGG
29nt
Col-Cre_rev
GCTTGAGCGTGACAATCACG
20nt
Cre157_fwd
AAAAGATCTAATACGCAAACCGCCTCTC
28nt
Cre157_rev
AAAGTTAACCCTCTTCGCTATTACGCCAG
29nt
Mediums
Here are documented all the mediums we used in our experiments.
Lysogeny Broth
Description
Lysogeny broth, abreviated LB, is a common bacterial growth medium. It's particularly suited for Escherichia coli growth.
Nutrient broth
Description
Nutrient broth, abreviated NB, is another common bacterial growth medium. its composition is verry similar to the LB one. It's commonly used for Cupriavidus metallidurans CH34 growth.
284
Description
284 (Mergeay, 1995; Schlegel et al., 1961) is a tris buffered medium supplemented in heavy metal salts. It's used to study bacteria heavy metal resistance. the recipe presented below is from S. Monchy's thesis [284 composition source].
Recipe
284 medium
ingredient
quantity
Tris
50mM
NaCl
80mM
KCl
20mM
NH4Cl
20mM
Na2SO4
3mM
MgCl2 6H2O
1mM
CaCl2 6H2O
0.2mM
Na2HPO4 2H2O
0.4% (v/v)
Fe(III)NH4 citrate
1% (v/v)
solution SL7
0.1% (v/v)
gluconate
0.2% (m/v)
SL7 solution
ingredient
quantity
HCl
10mM
ZnSO4 7H2O
0.5mM
MnCl2 4H2O
0.5mM
H3BO3
1mM
CoCl2 6H2O
0.8mM
CuCl2 2H2O
0.1mM
NiCl2 6H2O
0.1mM
Na2MoO4 2H2O
0.15mM
Super Optimal Broth with Catabolite Expression
Description
Super Optimal Broth with Catabolite Expression, abreviated SOC, is a medium designed to optimize bacterial transformation efficiency. Here, it is used to resuspend bacteria after the electroporation.
References
[conjugaison] Wiesemann N, Mohr J, Grosse C, et al. Influence of copper resistance determinants on gold transformation by Cupriavidus metallidurans strain CH34. J Bacteriol. 2013;195(10):2298–2308. doi:10.1128/JB.01951-12
[pCM184] Broad-host-range cre-lox system for antibiotic marker recycling in gram-negative bacteria. Marx CJ, Lidstrom ME. Biotechniques. 2002 Nov;33(5):1062-7. 10.2144/02335rr01 PubMed 12449384
[pCM157] Broad-host-range cre-lox system for antibiotic marker recycling in gram-negative bacteria. Marx CJ, Lidstrom ME. Biotechniques. 2002 Nov;33(5):1062-7. 10.2144/02335rr01 PubMed 12449384
[electroporation] Taghavi S, van der Lelie D, Mergeay M. Electroporation of Alcaligenes eutrophus with (mega) plasmids and genomic DNA fragments. Appl Environ Microbiol. 1994;60(10):3585–3591.
[pBBR1MCS-2] Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM 2nd, Peterson KM. Gene. 1995 Dec 1;166(1):175-6. 0378111995005841 [pii] PubMed 8529885
[biobrick] http://parts.igem.org/wiki/index.php?title=Part:BBa_K1122674
[pan] Ribeiro-dos-Santos, G., Biondo, R., Quadros, O. de F., Vicente, E. J., & Schenberg, A. C. G. (2010). A metal-repressed promoter from gram-positive Bacillus subtilis is highly active and metal-induced in gram-negative Cupriavidus metallidurans. Biotechnology and Bioengineering, 107(3), 469–477. https://doi.org/10.1002/bit.22820
[composition du millieu 284] Sebastien MONCHY, "Organisation et expression des gènes de résistance aux métaux lourds chez Cupriavidus métallidurans CH34", These de doctorat en Sciences de la vie sous la dirrection de Max MERGEAY et Ariane TOUSSAINT, Bruxelles, Uinversité Libre de Bruxelles, 2007, 99p