Team:Nantes/Improve
As previously mentioned in our project description, promoters for sugar degradation operon are highly regulated by multiple transcriptions factors in E.coli.
CRP (cAMP Receptor Protein) is a transcription activator able to interact with the alpha subunit of the RNApolymerase. When this protein bind to the specific DNA sites in or near the promoter it can recruit the DNA polymerase.
This protein also known as CAP for Catabolite Activator Protein is a homodimer capable of binding cAMP. (1)
cAMP signaling is linked with the metabolic need and energetic state during growth (2).The interaction causes conformational changes of CRP with a strong affinity to specific sequences of DNA allowing it to interact with the RNApolymerase.
Analysis (3) suggest that differential activation by CRP-cAMP can quantitatively explain much of the sugar hierarchy described in this publication.
Following this idea they managed to mutate the CRP binding site in a promoter to bring it close to its consensus sequence (AAATGTGATCTAGATCACATT (4) ). By increasing the ability to bind CRP they moved the promoter position to a higher place in the hierarchy.
In our project we decided to extend this strategy to the Arabinose promoter sequences available on the registry. We chose to focus on the well known BBa_I13453 (registry star) and BBa_K206000 (mutated on the Aral1 operator sites by British-Columbia 2009). Here you can find already optimized version we try to made : BBa_K2991003,BBa_K2991004 and BBa_K2991005
With each promoter activity relative to the level of CFP (or GFP depending on the construction). The idea was to compare for each original or mutated promoter the response in different medium conditions. We assumed that in presence of a higher ranked sugar (Lactose) with or without Arabinose, the optimized promoter would have show no inhibition and higher expression than its non-mutated version.
We weren’t able to observe relevant increase of fluorescence in any of our constructions (even in our the non-mutated registry sequences). We assume this issue to be link with the manipulation/cloning procedures. We can’t determine yet how much this mutation will impact Arabinose and tune the hierarchy.
(1)E. Fic et al., “Fax +41 61 306 12 34 E-Mail karger@karger.ch cAMP Receptor Protein from Escherichia coli as a Model of Signal Transduction in Proteins-A Review,” J Mol Microbiol Biotechnol, vol. 17, pp. 1–11, 2009.
(2)C. You et al., “Coordination of bacterial proteome with metabolism by cyclic AMP signalling,” Nature, vol. 500, no. 7462, pp. 301–306, 2013.
(3)G. Aidelberg, B. D. Towbin, D. Rothschild, E. Dekel, A. Bren, and U. Alon, “Hierarchy of non-glucose sugars in Escherichia coli,” BMC Syst. Biol., vol. 8, p. 133, 2014.
(4)I. M. Keseler et al., “EcoCyc: Fusing model organism databases with systems biology,” Nucleic Acids Res., vol. 41, no. D1, Jan. 2013.