Team:Nanjing High School/Improve
Improve
Improve
FixK2 (BBa_K592006)
fixk2-F(28a) |
ATTAATTGCGTTGCGCgccggagccgattatccgcacc |
PFix2-vector-R |
tttctcctctttctctagtatgtgacgcagtgcgcgcgcagcagttgag |
Cas3-F |
tactagagaaagaggagaaatactagatgcccgaacacgattctacagatg |
28a-R(dellacI) |
GCGCAACGCAATTAATGTAAGTTAG |
In former iGEM Team iGEM12_Columbia-Cooper-NYC (2012-10-01), they used FixK2 as a promoter which can function when activated by an inducer. In their experiments, FixK2 was used with FixJ and YF1 to cause cell death when exposed to blue light.
In Team iGEM14_NYMU-Taipei (2014-10-07), they constructed a killing gene with FixK2, which is regulated by blue light, to get safety lock.
This year we reconstructed pET28a-Cas3, a protein that is used to restrain Cas1-Cas2, with FixK2 to make it easier to design primer and function as Cas1-Cas2 inhibitor.
We first changed the promoter on pET28a-Cas3 and deleted lacI.We used FixK2-F(28a)/ PFix2-vector-R as the primer for fragment FixK2, and we used the plasmid with this promoter as template. We then used Cas3-F/28a-R(dellacI) as vector fragmentwith the template pET28a-Cas3.
pET28a-FixK2-Cas3 is a new kind of plasmid that can inhibit Cas1-Cas2 when there is blue light. FixK2 serves as a light promoter that can function when exposed to blue light and let Cas3 protein to express.
Blue Sensor
J23100-blue-sensor-F |
acagtgctagctactagagaaagaggagaaatactagatggctagttttcaatcatttg |
J23100-blue-sensor-R |
tagcactgtacctaggactgagctagccgtcaaATTTCCTAATGCAGGAGTCGCATAAG |
Blue sensor is a composite of YF1(light-regulated histidine kinases) and FixJ(transcriptional regulatory protein)constructedby Shang Hai Jiao Tong University. Because YF1 and FixJ is supposed to be construct on plasmid pCDFDuet-1, we should change the promoter.
We first used J23100-Blue-Sensor-F/J23100-blue-sensor-R as primer and the Blue Sensor plasmid to do PCR. After gel analysis was correct, we added DpnI and transferred the plasmid to E. coli to make it self-ligate.
pACYCDuet-R |
tagtagctagcactgtacctaggactgagctagccgtcaaATTTCCTAATGCAGGAGTC |
pACYCDuet-R-2 |
tctctagtagctagcactgtacctaggactgagctagccgtcaaATTTCCTAATGCAGGAGTCGCATAAG |
J23100-blue-sensor-F |
acagtgctagctactagagaaagaggagaaatactagatggctagttttcaatcatttg |
pACYCDuet-F |
tactagagCTGCTGCCACCGCTGAGCAATAAC |
FixJ-R |
CGGTGGCAGCAGctctagtattattaatcgttgagcatgc |
To transfer Blue Sensor to pACYC-Duet, we then use J23100-blue-sensor-F/FixJ-R as primer to amplify plasmid with Blue Sensor and pACYCDuet-F/pACYCDuet-R as primer to amplify plasmid pACYCDuet-1.This reconstructed Blue Sensor can now function after being induced, which enables us to record time with other cells when there is blue light. As a result, we have improved the plasmid to make our experiment workable and also to help other iGem teams in the future.
Here is our results
During our project, we have designed a new part to record the time E.coli is exposed to blue light. Cas1-Cas2 is a special protein that can catch fragments. In our experiment, we transferred the plasmid with this protein to the micro-organism so that when the micro-organism is placed under blue light, the promoter will function and the protein will then begin to catch fragments. After a certain amount of time, gel analysis we did to examine the result showed that samples under blue light had a shorter strip, which meant Cas1-Cas2 effectively caught and stored the fragments.
Significant length growth in T1 cells are found.
No length growth in DF1 and F1 cells.
No length growth in DF3 cells. Significant length growth in F3 cells.
Another experiment result
