Our preliminary research made it clear that detecting phytoplasma DNA directly from contaminated plant extract was impossible, as the amounts present were too low. It was necessary to begin by increasing the amount of DNA with an
As it will be explained in the Detection page, the amplified DNA will need to be transcribed into RNA. To that end, we decided to add a T7 promoter to the amplified sequences.
At the beginning of the project, we considered a few different amplification methods. Our criterias were as follow :
Our 3 main candidates were :
NASBA |
LAMP |
RPA |
|
|---|---|---|---|
Isothermal |
 |
 |
|
Multiplexable |
|
|
|
Fast |
|
|
|
As it matched all of our requirements, we chose to work with RPA1
The TwistDx guidelines 2 recommend the following parameters for the target sequence :
The first condition quickly turned out to be more problematic than expected, as phytoplasmas usually have a genomic GC content between 21 and 33% 3.
We started by looking at the Hren et al. paper4 detailing the detection method cited by the European and Mediterranean Plant Protection Organisation (EPPO) protocol 5.
The target sequence for BN is derived from a Candidatus Phytoplasma solani genomic sequence (GenBank accession number AF447593) used in the Hren et al. paper. The sequence was analyzed in silico to confirm that it contained potential amplicons with >40% GC. The sequence was then BLASTed to test for specificity, which only elicited matches for stolbur phytoplasmas (stolbur is the name given to the disease caused by Candidatus P. solani in every plant beside grapevine).
The choice of a target sequence was a lot less straightforward for FD. The sequence described in the Hren et al paper is a fragment of the SecY gene. The sequence has an average GC content of 23.75% and doesn't contain a single sequence of ≥100 bp with more than 35% GC. SecY was out, we needed to find a new sequence for FD.
Figure 1 : Analysis of the GC content of the SecY sequence, generated by computing the GC content of fragments of varying lengths (80 bp; 100 bp; 120 bp; 150 bp) at each position of the sequence
Phytoplasma strains are classified based on their 16S ribosomal RNA. For instance, C. phytoplasma vitis (Flavescence Dorée) belongs to the 16SrV, while C. phytoplasma solani (Bois Noir) belongs to the 16SrXII group. We decided to try the R16F2n/R16R2 (F2N/R2) fragment of the 16S ribosomal RNA gene. This sequence is used as an identification sequence in various studies involving Candidatus phytoplasmas.
We aligned 7 sequences of the F2N/R2 gene from Candidatus phytoplasma vitis, but also from Candidatus phytoplasma solani (Bois noir) and other phytoplasma strains from the 16SrV group to assess specificity (additional material, table 3). Alignment was performed using the online analysis tool Benchling.com, generating a consensus sequence. The target sequence was selected from the consensus sequence, in a region with high 16SrV identity and low 16SrXII compatibility. The target sequence was then BLASTed to confirm that it did not match any known sequence from Bois Noir, other diseases or grapevine.
Figure 2 : Alignement of FD, FD-related (16Srv) and BN R16F2n/R16R2 sequences. The target sequence was again selected from the consensus sequence, in a region with high 16SrV identity and low 16SrXII compatibility.
Figure 3 : Analysis of the GC content of the F2N/R2 consensus sequence, generated by computing the GC content of fragments of varying lengths (100 bp; 120 bp; 150 bp) at each position of the sequence
We considered a few other barcode genes (such as tuf and map), but the F2N/R2 turned out to be an excellent candidate for detection : well-documented in most phytoplasma strains, with a high GC content and strong specificity.
When asked about what requirements our test needed to fulfill to be usable, the Agroscope expert told us that we needed to be able to detect a third sequence, neither BN nor FD. This sequence would need to be present regardless of whether FD or BN were present as well, and would serve two purposes :
This control sequence is what we refer to as endogenous control, or EC for short.
For the target sequence, we chose to work with a gene from the V. vinifera chloroplast genome. More specifically, an intronic region of the tRNA-Leu (trnl) gene. We chose to use that gene because the chloroplast genome is well-documented and the trnl gene is highly conserved in all plants, which is essential since our control needs to work for all grapevine cultivars.
To construct the target sequence, we aligned 8 sequences from V. vinifera cultivars, subspecies and closely related species (additional material, table 2). The alignment confirmed the high level of similarities between the sequences. The target sequence was again selected within the generated consensus sequence.
Figure 4 : Alignement of trnl sequences from Vitis vinifera cultivars, subspecies and closely related species.
The final target sequences can be found in table 1 of the additional materials.
The TwistDx guidelines 2 recommend the following parameters for the RPA primers :
The primers were designed on Benchling.com. We designed 3 primer pairs for FD, 4 for EC and 6 for BN. Primer sequences can be found in additional materials, table 4. We then performed a screening assay for each target sequence, following the following template :
By the end of this step, we had selected 1 reverse primer and 2 forward primers for each target sequence (additional materials, table 5).
For more information on screening assay, again refer to the TwistDx guidelines.
Our method of detection requires a transcription step, which is carried out by an enzyme called the
AATTCTAATACGACTCACTATAGGG
Transcription begins at the guanine indicated in bold.
After we had chosen the primer pairs, we added a T7 promoter to each forward primer and performed a new screening assay to select a single forward primer per sequence. Results can be found in additional materials, table 6.
Figure 5 : Agarose gel electrophoresis of the 3 sequences with and without the T7 promoter (50 bp ladder)
Once we had selected the primers, the next step was to assess the limit of detection. We tested the primers at increasingly small DNA sequence concentrations. RPA was performed at 37°C for 20 min. Presence of amplicons was assessed by agarose gel electrophoresis and confirmed by Sanger sequencing.
Agarose gel electrophoresis showed specific amplification for as low as 1000 copies/μl. For samples below 1E3, the gel presents a "ladder pattern", which is the result of non-specific amplifications caused by a low template concentration 7.
We then sent the last four samples (1E2, 1E1, 1E0 and DNA-free control) for sequencing with the T7 primer. 1E2 and 1E1 came back positive (alignment shown on fig. 6, sequences in Table 7 of additional materials) while 1E0 and the control came back negative.
Sanger sequencing is known to be inaccurate at the ends of the sequence, as we see this in the alignment. The middle sequences, however, match perfectly with the FD amplicon.
This has shown that we can detect the FD amplicon with as few as 10 copies/μl.
Figure 6 : Agarose gel electrophoresis and sequence alignements of limit of detection of FD synthetic DNA
Regrettably, we were unable to assess the limit of detection with BN because of systematic contaminations (possibly of our stock RPA solutions).
Finally, we needed to know if the three amplifications could be carried out in one solution. We tested all combinations of each primer pair in a mixture of the 3 equally-concentrated synthetic sequences.
Figure 7 : Agarose gel electrophoresis of multiplexed RPA (50 bp ladder)
The multiplexing was successful both in duplex and triplex reactions. EC appears to be more amplified than BN and FD, so we may need to adjust the concentrations of primers accordingly.
We wanted to know if the RPA would be hindered by the presence of plant coumpounds extracted along with the DNA (in particular, phenols and polysaccharides are known to act as PCR inhibitors 8). Using our microneedle method, we extracted the DNA of an uninfected grapevine leaf. We then carried out two experiments :
Figure 8 : Agarose gel electrophoresis of RPA for EC and FD in microneedle extract (50 bp ladder)
The endogenous control amplification was successful in MNE.
The limit of detection seems to show bands for FD as low as 10 copies/μl (50 copies total). We can again see the "ladder pattern" for concentrations equal to or below 1000 copies/μl. For a more precise assessment of the limit of detection, we sequenced the samples with the lowest concentrations.
Sequencing of the control was unsuccessful as expected, while sequencing of FD came back positive for all samples (1E5 to 1E1). This demonstrates that we can detect FD at concentrations as low as 10 copies/µl from plant extract.
We have shown that our extraction method allows for successful downstream amplification, with no loss of sensitivity.
Finally, it was time to test our RPA on phytoplasma infected leaves. Under the supervision of the phytosanitary officer, we sampled infected leaves on vine stock that had already been tested by Agroscope. The vineyard where we took our samples is called the "training plot" ("parcelle d'exercice"). It is a heavily infected piece of vineyard, located at the epicenter of the contamination zone. The confirmed Flavescence Dorée-infected vine stocks are painted yellow, and the confirmed Bois Noir-infected ones are painted orange.
We sampled leaves from FD-infected and BN-infected plants. The non-infected plant was sampled in a different vineyard, outside the contamination zone.
Back to the lab, we performed the extraction with our microneedle patches and decided to also test our prototype. We then performed two RPAs on the samples : one to amplify EC and one to amplify FD.
Figure 9 : Expected results of the grapevine samples testing (+ : amplification; - : no amplification)
Figure 10 : Agarose gel electrophoresis of amplification of EC sequence by RPA on different grapevine extracts (50 bp ladder)
The amplification of the EC sequence shows that chloroplast DNA was successfully extracted from every grapevine sample.
Furthermore, we have shown it is possible to amplify DNA extracted using our prototype (Mk I).
Figure 11 : Agarose gel electrophoresis of amplification of FD sequence by RPA on different grapevine extracts)
The gel shows amplification in lanes 1-3, and the ladder pattern (i.e. no amplification) in lanes 4-6. The amplification in lane 2 is inconsistent with the expected results. The most plausible explanation is DNA contamination, as it is unlikely that the sample be infected with Flavescence Dorée since we picked it outside the contamination zone.
To test that our amplicons could indeed be transcribed, we did an in vitro transcription reaction using HiScribe™ T7 Quick High Yield RNA Synthesis Kit. The transcription product were detected by electrophoresis on a 2% denaturing agarose gel.
Figure 12 : Agarose gel electrophoresis of post-RPA transcription product
The transcription of all 3 RPA products (lanes 1, 4 and 7) is similar to that or their synthetic counterpart sequences with T7 (lanes 2, 5 and 8). This means that RPA was successful in adding a functional T7 promoter to the amplified sequences.
For our project, we decided to work with an isothermal amplification method known for its high sensitivity :
RPA has a very high sensitivity, which has shown to be a double-edged sword. Contamination is a recurring issue with this method, as a few copies of DNA are enough to induce amplification.
To go further, we could have done an experiment to compare RPA with the standard nested PCR on infected leaves. Another interesting experiment would have been to test our method on asymptomatic leaves from diseased plants, to determine if our test could be used before the plant shows the first symptoms..
2 Lobato, I.M., O'Sullivan, C.K., Recombinase polymerase amplification: Basics, applications and recent advances [link to article]
2 TwistAmp® DNA Amplification Kits : Assay Design Manual
3 Kube, M. et al, Current View on Phytoplasma Genomes and Encoded Metabolism [link to article]
4 Hren, M. et al, Real-time PCR detection systems for Flavescence dorée and Bois noir phytoplasmas in grapevine: comparison with conventional PCR detection and application in diagnostics [link to article]
5 EPPO, PM 7/079 (2) Grapevine flavescence dorée phytoplasma [link to article]
6 Pardee, K. et al, Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components (Supplemental Materials) [link to article]
7 Piepenburg, O. et al, DNA Detection Using Recombination Proteins [link to article]
8 Schrader, C et al, PCR inhibitors–occurrence, properties and removal [link to article]