Difference between revisions of "Team:CSMU Taiwan/Improve"
Oliver0423 (Talk | contribs) |
Oliver0423 (Talk | contribs) |
||
| Line 3: | Line 3: | ||
<html> | <html> | ||
<style type="text/css"> | <style type="text/css"> | ||
| − | |||
figure { | figure { | ||
margin-block-start: 1em; | margin-block-start: 1em; | ||
| Line 20: | Line 19: | ||
| − | .pictureTitle{ | + | .pictureTitle { |
| − | + | ||
| − | + | ||
background-repeat: no-repeat; | background-repeat: no-repeat; | ||
background-size: cover; | background-size: cover; | ||
| − | background-position:center; | + | background-position: center; |
} | } | ||
| + | |||
.ImgContainer { | .ImgContainer { | ||
| − | + | position: relative; | |
| − | + | cursor: zoom-in; | |
} | } | ||
.Img { | .Img { | ||
| − | + | display: block; | |
| − | + | width: 100%; | |
| − | + | height: auto; | |
| − | + | opacity: 1; | |
| − | + | border-width: 2px !important; | |
| − | + | border-color: white; | |
} | } | ||
.ImgOverlay { | .ImgOverlay { | ||
| − | + | position: absolute; | |
| − | + | top: 0; | |
| − | + | bottom: 0; | |
| − | + | left: 0; | |
| − | + | right: 0; | |
| − | + | height: 100%; | |
| − | + | width: 100%; | |
| − | + | opacity: 0; | |
| − | + | visibility: hidden; | |
| − | + | transition: .5s ease; | |
| − | + | background-color: rgba(30, 30, 30, 1); | |
| − | + | z-index: 99; | |
} | } | ||
.ImgContainer:hover .ImgOverlay { | .ImgContainer:hover .ImgOverlay { | ||
| − | + | opacity: 1; | |
} | } | ||
| − | + | ||
.ImgContainer.mobileShow .ImgOverlay { | .ImgContainer.mobileShow .ImgOverlay { | ||
| − | + | visibility: visible; | |
| − | + | opacity: 0.97; | |
| − | + | transition: .5s ease; | |
| − | } | + | } |
| + | |||
.ImgContainer.mobileShow .Img { | .ImgContainer.mobileShow .Img { | ||
| − | + | transition: .5s ease; | |
| − | + | opacity: 1; | |
| − | } | + | } |
| + | |||
.ImgContainer.mobileShow { | .ImgContainer.mobileShow { | ||
| − | + | cursor: zoom-out; | |
| − | } | + | } |
.ImgText { | .ImgText { | ||
| − | + | color: rgba(220, 220, 220, 1); | |
| − | + | position: absolute; | |
| − | + | top: 15%; | |
| − | + | left: 10%; | |
| − | + | -webkit-transform: translate(-5%, -10%); | |
| − | + | -ms-transform: translate(-5%, -10%); | |
| − | + | transform: translate(-5%, -10%); | |
} | } | ||
| − | .ImgText p{ | + | |
| − | font-size:16px; | + | .ImgText p { |
| − | color:#ffffff; | + | font-size: 16px; |
| + | color: #ffffff; | ||
} | } | ||
| − | .ImgText b{ | + | |
| − | + | .ImgText b { | |
| − | + | font-size: 20px; | |
| + | color: rgba(255, 255, 255, 1); | ||
} | } | ||
| − | + | ||
.parallax { | .parallax { | ||
/* The image used */ | /* The image used */ | ||
| − | + | ||
/* Full height */ | /* Full height */ | ||
| − | height: 50vh; | + | height: 50vh; |
/* Create the parallax scrolling effect */ | /* Create the parallax scrolling effect */ | ||
| Line 108: | Line 112: | ||
background-size: cover; | background-size: cover; | ||
} | } | ||
| − | + | ||
@media only screen and (max-width: 575.98px) { | @media only screen and (max-width: 575.98px) { | ||
| − | .ImgText { | + | .ImgText { |
| − | + | font-size: 1rem; | |
| − | } | + | } |
} | } | ||
@media only screen and (min-width: 575.98px) { | @media only screen and (min-width: 575.98px) { | ||
| − | .ImgText { | + | .ImgText { |
| − | font-size: 1.5rem; | + | font-size: 1.5rem; |
| − | } | + | } |
} | } | ||
@media only screen and (min-width: 767.98px) { | @media only screen and (min-width: 767.98px) { | ||
| − | .ImgText { | + | .ImgText { |
| − | font-size: 1rem; | + | font-size: 1rem; |
| − | } | + | } |
} | } | ||
| Line 131: | Line 135: | ||
@media only screen and (min-width: 991.98px) { | @media only screen and (min-width: 991.98px) { | ||
| − | .ImgText { | + | .ImgText { |
| − | font-size: 1.2rem; | + | font-size: 1.2rem; |
| − | } | + | } |
} | } | ||
@media only screen and (min-width: 1199.98px) { | @media only screen and (min-width: 1199.98px) { | ||
| − | .ImgText { | + | .ImgText { |
| − | font-size: 1rem; | + | font-size: 1rem; |
| − | } | + | } |
| − | .ImgOverlay { | + | |
| − | + | .ImgOverlay { | |
| − | + | width: 100%; | |
| − | + | top: 100%; | |
| − | } | + | height: 140%; |
| − | .Img { | + | } |
| − | + | ||
| + | .Img { | ||
| + | transition: .5s ease; | ||
| + | } | ||
| + | |||
} | } | ||
| − | + | .Img:nth-child(2) { | |
| − | .Img:nth-child(2){ | + | |
position: absolute; | position: absolute; | ||
top: 0; | top: 0; | ||
left: 0; | left: 0; | ||
| − | + | opacity: 0; | |
| − | + | transition: opacity 0.3s ease-in-out | |
} | } | ||
| − | .Img:nth-child(2):hover{ | + | |
| − | + | .Img:nth-child(2):hover { | |
| + | opacity: 1; | ||
} | } | ||
| − | .geneRow{ | + | .geneRow { |
height: 15%; | height: 15%; | ||
| − | |||
border-radius: 30px; | border-radius: 30px; | ||
| − | padding: | + | padding: 10px 17px; |
margin: 20px; | margin: 20px; | ||
} | } | ||
| + | |||
/************************************************************************ | /************************************************************************ | ||
Tables | Tables | ||
| Line 277: | Line 285: | ||
<div id="logoPrinteria" class="item" style="background-image: url(https://static.igem.org/mediawiki/2019/f/f2/T--CSMU_Taiwan--cover_part.jpeg);height: 100%; width: 100%;background-attachment: fixed;background-size: cover;"> | <div id="logoPrinteria" class="item" style="background-image: url(https://static.igem.org/mediawiki/2019/f/f2/T--CSMU_Taiwan--cover_part.jpeg);height: 100%; width: 100%;background-attachment: fixed;background-size: cover;"> | ||
<img src="https://static.igem.org/mediawiki/2019/f/f5/T--CSMU_Taiwan--improve_.png" style=" margin-top: 0px;"> | <img src="https://static.igem.org/mediawiki/2019/f/f5/T--CSMU_Taiwan--improve_.png" style=" margin-top: 0px;"> | ||
| − | |||
</a> | </a> | ||
</div> | </div> | ||
</div> | </div> | ||
| − | |||
| − | |||
</center> | </center> | ||
</div> | </div> | ||
| Line 291: | Line 296: | ||
<div class="container"> | <div class="container"> | ||
<div class="col-8 offset-2"> | <div class="col-8 offset-2"> | ||
| − | + | <h2>Abstract</h2> | |
| − | + | <p>This year, we aim to develop a rapid screening kit for influenza. To enable the kit to become a tool to further obtain more detailed epidemiology statistics for better measures of prevention. Thus, one of the aspects of our project is to distinguish between the subtypes of influenza with Hemagglutinin (HA). To select aptamers against HA, expression of a certain amount is needed. However, the lack of general technical platform for the timely supply of soluble and highly purified influenza HA presents a bottleneck for the subsequent analysis for the effective control of the viral disease. </p> | |
| − | <p>For this reason, we are contributing to the iGEM community with <a href="http://parts.igem.org/Part:BBa_K2951008">BBa_K2951008</a> by improving an existing part: <a href="http://parts.igem.org/Part:BBa_K1955000">BBa_K1955000</a>, codon optimizing it and also using the Escherichia coli (E. coli) lysyl tRNA synthetase (LysRS) as a fusion partner. In addition to express hemagglutinin in soluble form efficiently, we also added His-tag, TEV cutting site and polylinker in order to construct a plasmid for further purification, aptamer selection, and applications for other hemagglutinin subtypes. Detailed descriptions can be seen in the following section</p> | + | <p>For this reason, we are contributing to the iGEM community with <a href="http://parts.igem.org/Part:BBa_K2951008">BBa_K2951008</a> by improving an existing part: <a href="http://parts.igem.org/Part:BBa_K1955000">BBa_K1955000</a>, codon optimizing it and also using the Escherichia coli (E. coli) lysyl tRNA synthetase (LysRS) as a fusion partner. In addition to express hemagglutinin in soluble form efficiently, we also added His-tag, TEV cutting site and polylinker in order to construct a plasmid for further purification, aptamer selection, and applications for other hemagglutinin subtypes. Detailed descriptions can be seen in the following section</p> |
| − | + | </div> | |
| − | </div> | + | |
<div class="row"> | <div class="row"> | ||
<div class="col-md-7 offset-1 col9Attr" data-spy="scroll" data-target="#myScrollspy" style="padding-left: 6em;padding-right: 2em;"> | <div class="col-md-7 offset-1 col9Attr" data-spy="scroll" data-target="#myScrollspy" style="padding-left: 6em;padding-right: 2em;"> | ||
| Line 303: | Line 307: | ||
<img src="https://static.igem.org/mediawiki/2019/8/88/T--CSMU_Taiwan--student3-1.png" alt="Avatar" class="Img border"> | <img src="https://static.igem.org/mediawiki/2019/8/88/T--CSMU_Taiwan--student3-1.png" alt="Avatar" class="Img border"> | ||
</figure> | </figure> | ||
| − | |||
</div> | </div> | ||
</div> | </div> | ||
| − | |||
<div class="col-md-4"> | <div class="col-md-4"> | ||
| − | <div class="row geneRow"> | + | <div style="vertical-align: middle;"> |
| − | + | <div class="row geneRow" style="background-color: pink;"> | |
| − | + | <div class="col-12"> | |
| + | <p>Sequence Optimization</p> | ||
| + | </div> | ||
</div> | </div> | ||
| − | + | <div class="row geneRow" style="background-color: rgb(255,223,43);"> | |
| − | + | <div class="col-12"> | |
| − | + | <p>TEV Cutting Site</p> | |
| − | + | </div> | |
| − | + | ||
| − | + | ||
</div> | </div> | ||
| − | + | <div class="row geneRow" style="background-color: rgb(115,183,158);"> | |
| − | + | <div class="col-12"> | |
| − | + | <p>Further Applications</p> | |
| − | + | </div> | |
</div> | </div> | ||
| − | + | <div class="row geneRow" style="background-color: rgb(121,206,226);"> | |
| − | + | <div class="col-12"> | |
| − | + | <p>Improved Solubility</p> | |
| − | + | </div> | |
</div> | </div> | ||
| − | </div> | + | </div> |
</div> | </div> | ||
</div> | </div> | ||
<div class="row"> | <div class="row"> | ||
<div class="col-8 offset-2"> | <div class="col-8 offset-2"> | ||
| − | + | <h3>Sequence selection and Codon Optimization</h4> | |
| − | <h3>Sequence selection and Codon Optimization</h4> | + | <p>The previous part (BBa_K1955000) was documented to be acquired from NCBI with no further indication. The sequence of HA strain(A/WSN 1933/TS61(H1N1)) is based on <a href="https://www.ncbi.nlm.nih.gov/nucleotide/CY010788.1?report=genbank&log$=nuclalign&blast_rank=2&RID=F439K4B5015%22%20target=%22blank%22">NCBI(CY010788.1)</a>, being 7 bp difference to the precious part(Fig.1). </p> |
| − | <p>The previous part (BBa_K1955000) was documented to be acquired from NCBI with no further indication. The sequence of HA strain(A/WSN 1933/TS61(H1N1)) is based on <a href="https://www.ncbi.nlm.nih.gov/nucleotide/CY010788.1?report=genbank&log$=nuclalign&blast_rank=2&RID=F439K4B5015%22%20target=%22blank%22">NCBI(CY010788.1)</a>, being 7 bp difference to the precious part(Fig.1). </p> | + | <p>To express the target protein, we chose to use BL21 E.coli strain with a pET29a vector. In order to improve the expression efficiency of our chassis, we first codon optimized the sequence and checked for illegal cutting sites using ATGme for E.coli. </p> |
| − | <p>To express the target protein, we chose to use BL21 E.coli strain with a pET29a vector. In order to improve the expression efficiency of our chassis, we first codon optimized the sequence and checked for illegal cutting sites using ATGme for E.coli. </p> | + | <img src="https://static.igem.org/mediawiki/2019/5/56/T--CSMU_Taiwan--improve3.jpeg" alt="" text" in case image doesn’t appear style="width: 80%; height: auto;"> |
| − | <img src="https://static.igem.org/mediawiki/2019/5/56/T--CSMU_Taiwan--improve3.jpeg" alt=""text" in case image doesn’t appear style="width: 80%; height: auto;"> | + | <p>Figure 1. Sequence alignment of NCBI(CY010788.1) AND BBa_K1955000 protein coding part. The 7bp difference is indicated by color yellow. </p> |
| − | <p>Figure 1. Sequence alignment of NCBI(CY010788.1) AND BBa_K1955000 protein coding part. The 7bp difference is indicated by color yellow. </p> | + | <h3>Improved Solubility</h3> |
| − | <h3>Improved Solubility</h3> | + | <p>First, we analyzed the transmembrane domain of HA using <a href=" http://www.cbs.dtu.dk/services/TMHMM/">TMHMM Server</a> (Fig.2) to delete its coding sequence and the four hydrophobic amino acids’ in front, which is a total of 35 a.a. . </p> |
| − | + | <img src="https://static.igem.org/mediawiki/2019/9/98/T--CSMU_Taiwan--improve2.jpeg" alt="" text" in case image doesn’t appear style="width: 80%; height: auto;"> | |
| − | <img src="https://static.igem.org/mediawiki/2019/9/98/T--CSMU_Taiwan--improve2.jpeg" alt=""text" in case image doesn’t appear style="width: 80%; height: auto;"> | + | <p>Fig.2 Transmembrane domain of analyzed by TMHMM </p> |
| − | <p>Fig.2 Transmembrane domain of analyzed by TMHMM </p> | + | <p>Second, we added a novel fusion partner to promote its folding and solubility--Escherichia coli (E. coli) lysyl tRNA synthetase (LysRS), whose coding sequence was obtained from NCBI (<a href=" https://www.ncbi.nlm.nih.gov/nuccore/NC_000913.3?report=genbank&from=3033657&to=3035174&strand=true ">NC_000913.3</a>). The sequence is also optimized and checked for illegal restriction sites. </p> |
| − | + | <h3>TEV Cutting site</h3> | |
| − | <h3>TEV Cutting site</h3> | + | <p>Considering that our expressed HA will be used as a target protein for further aptamer selection with SELEX, the removal of the protein generated from LysRS is needed. Thus, we added a TEV protease cutting site (GAAAACCTGTATTTTCAGGGC) obtained from <a href=" http://parts.igem.org/Part:BBa_K1319016 ">BBa_K1319016</a> between the coding sequence of LysRS and HA. </p> |
| − | + | <h3>Further Applications</h3> | |
| − | <h3>Further Applications</h3> | + | <p>Adding the histidine tag creates the opportunity to use a simpler method of purification, as well as increase selectivity for the desired protein, which is necessary for the next step of SELEX after expression. </p> |
| − | <p>Adding the histidine tag creates the opportunity to use a simpler method of purification, as well as increase selectivity for the desired protein, which is necessary for the next step of SELEX after expression. </p> | + | <p>Furthermore, with a view to construct a plasmid as a ready-made vector for high yield soluble different HA subtypes, we designed a polylinker(Fig.3) between LysRS and HA. </p> |
| − | + | <img src="https://static.igem.org/mediawiki/2019/3/3d/T--CSMU_Taiwan--improve1.png" alt="" text" in case image doesn’t appear style="width: 80%; height: auto;"> | |
| − | <img src="https://static.igem.org/mediawiki/2019/3/3d/T--CSMU_Taiwan--improve1.png" alt=""text" in case image doesn’t appear style="width: 80%; height: auto;"> | + | <h3>Experimental Data</h3> |
| − | <h3>Experimental Data</h3> | + | <p>This year, we aim to develop a rapid screening kit for influenza. To enable the kit to become a tool to further obtain more detailed epidemiology statistics for better measures of prevention. Thus, one of the aspects of our project is to distinguish between the subtypes of influenza with Hemagglutinin (HA). To select aptamers against HA, expression of a certain amount is needed. However, the lack of general technical platform for the timely supply of soluble and highly purified influenza HA presents a bottleneck for the subsequent analysis for the effective control of the viral disease. </p> |
| − | + | <h3>Reference</h3> | |
| − | + | <p>1.Yo Han Jang, Seung HeeCho, Ahyun Son, Yun Ha Lee, Jin hee Lee, Kwang-Hee Lee, Baik Lin Seong, High-yield soluble expression of recombinant influenza virus antigens from Escherichia coli and their potential uses in diagnosis, Journal of Virological Methods,Volume 196, February 2014, Pages 56-64 (<a href="https://doi.org/10.1016/j.jviromet.2013.10.035 ">https://doi.org/10.1016/j.jviromet.2013.10.035</a>)</p> | |
| − | <h3>Reference</h3> | + | </div> |
| − | <p>1.Yo Han Jang, Seung HeeCho, Ahyun Son, Yun Ha Lee, Jin hee Lee, Kwang-Hee Lee, Baik Lin Seong, High-yield soluble expression of recombinant influenza virus antigens from Escherichia coli and their potential uses in diagnosis, Journal of Virological Methods,Volume 196, February 2014, Pages 56-64 (<a href="https://doi.org/10.1016/j.jviromet.2013.10.035 ">https://doi.org/10.1016/j.jviromet.2013.10.035</a>)</p> | + | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
</div> | </div> | ||
</div> | </div> | ||
| Line 370: | Line 367: | ||
<script type="text/javascript"> | <script type="text/javascript"> | ||
$(function() { | $(function() { | ||
| − | $(".ImgContainer").click(function() { | + | $(".ImgContainer").click(function() { |
| − | + | $(".ImgContainer").not(this).removeClass("mobileShow"); | |
| − | + | $(this).toggleClass("mobileShow"); | |
| − | }); | + | }); |
| − | }); | + | }); |
| − | + | removeSection = function(e) { | |
| − | + | $(e).parents(".section").remove(); | |
| − | + | $('[data-spy="scroll"]').each(function() { | |
| − | + | var $spy = $(this).scrollspy('refresh') | |
| − | + | }); | |
| − | + | } | |
| − | + | $("#myScrollspy").scrollspy(); | |
}); | }); | ||
</script> | </script> | ||
| − | |||
</body> | </body> | ||
</html> | </html> | ||
{{CSMU Taiwan/footer}} | {{CSMU Taiwan/footer}} | ||
Revision as of 09:41, 20 October 2019
Abstract
This year, we aim to develop a rapid screening kit for influenza. To enable the kit to become a tool to further obtain more detailed epidemiology statistics for better measures of prevention. Thus, one of the aspects of our project is to distinguish between the subtypes of influenza with Hemagglutinin (HA). To select aptamers against HA, expression of a certain amount is needed. However, the lack of general technical platform for the timely supply of soluble and highly purified influenza HA presents a bottleneck for the subsequent analysis for the effective control of the viral disease.
For this reason, we are contributing to the iGEM community with BBa_K2951008 by improving an existing part: BBa_K1955000, codon optimizing it and also using the Escherichia coli (E. coli) lysyl tRNA synthetase (LysRS) as a fusion partner. In addition to express hemagglutinin in soluble form efficiently, we also added His-tag, TEV cutting site and polylinker in order to construct a plasmid for further purification, aptamer selection, and applications for other hemagglutinin subtypes. Detailed descriptions can be seen in the following section
Sequence Optimization
TEV Cutting Site
Further Applications
Improved Solubility
Sequence selection and Codon Optimization
The previous part (BBa_K1955000) was documented to be acquired from NCBI with no further indication. The sequence of HA strain(A/WSN 1933/TS61(H1N1)) is based on NCBI(CY010788.1), being 7 bp difference to the precious part(Fig.1).
To express the target protein, we chose to use BL21 E.coli strain with a pET29a vector. In order to improve the expression efficiency of our chassis, we first codon optimized the sequence and checked for illegal cutting sites using ATGme for E.coli.
Figure 1. Sequence alignment of NCBI(CY010788.1) AND BBa_K1955000 protein coding part. The 7bp difference is indicated by color yellow.
Improved Solubility
First, we analyzed the transmembrane domain of HA using TMHMM Server (Fig.2) to delete its coding sequence and the four hydrophobic amino acids’ in front, which is a total of 35 a.a. .
Fig.2 Transmembrane domain of analyzed by TMHMM
Second, we added a novel fusion partner to promote its folding and solubility--Escherichia coli (E. coli) lysyl tRNA synthetase (LysRS), whose coding sequence was obtained from NCBI (NC_000913.3). The sequence is also optimized and checked for illegal restriction sites.
TEV Cutting site
Considering that our expressed HA will be used as a target protein for further aptamer selection with SELEX, the removal of the protein generated from LysRS is needed. Thus, we added a TEV protease cutting site (GAAAACCTGTATTTTCAGGGC) obtained from BBa_K1319016 between the coding sequence of LysRS and HA.
Further Applications
Adding the histidine tag creates the opportunity to use a simpler method of purification, as well as increase selectivity for the desired protein, which is necessary for the next step of SELEX after expression.
Furthermore, with a view to construct a plasmid as a ready-made vector for high yield soluble different HA subtypes, we designed a polylinker(Fig.3) between LysRS and HA.
Experimental Data
This year, we aim to develop a rapid screening kit for influenza. To enable the kit to become a tool to further obtain more detailed epidemiology statistics for better measures of prevention. Thus, one of the aspects of our project is to distinguish between the subtypes of influenza with Hemagglutinin (HA). To select aptamers against HA, expression of a certain amount is needed. However, the lack of general technical platform for the timely supply of soluble and highly purified influenza HA presents a bottleneck for the subsequent analysis for the effective control of the viral disease.
Reference
1.Yo Han Jang, Seung HeeCho, Ahyun Son, Yun Ha Lee, Jin hee Lee, Kwang-Hee Lee, Baik Lin Seong, High-yield soluble expression of recombinant influenza virus antigens from Escherichia coli and their potential uses in diagnosis, Journal of Virological Methods,Volume 196, February 2014, Pages 56-64 (https://doi.org/10.1016/j.jviromet.2013.10.035)