Team:CSMU Taiwan/Characterization
Abstract
The characterization of BBa_K1319004 was carried out. This part is a TEV protease (also known as Tobaco Edge Virus nuclear inclusion a endopeptidase) that was optimized for expression in E. coli. The part contains the S219V anti-self cleavage mutation. The TEV Protease is a highly sequence specific cysteine protease from the Tobacco Edge Virus (TEV). The protease is highly sequence specific. The consensus sequence for the cut is ENLYFQ\S with \ denoting the cleaved peptide bond. This sequence can be found in the part BBa_K1319016. Because of its stringent sequence specificity, tobacco etch virus (TEV) protease emerges as a useful reagent with wide application in the cleavage of recombinant fusion proteins. Thus, we have chosen TEV protease(sequence from BBa_K1319004) to remove the fusion protein in our another part BBa_K2951008 and be characterized.
Cloning
To characterize the TEV protease, the chosen vector for expression is pET29a which includes a 6xHis-Tag fusion on the plasmid following the insert. At both anchors at the restriction sites for BamHI and XhoI were introduced to clone the genes into a pET29a vector by PCR with overhang primers primer1(TEV-fwd) and primer2(TEV-rev).
| Name | 5'-3' primers sequences |
|---|---|
| TEV-fwd | AATTGCGGATCCGGCGAAAGCCTGTTCAAAGGTC |
| TEV-rev | AATTGCCTCGAGACCACCTTGGGAGTAGACCAGTTCATTC |
The PCR result is observed by running a 1.8% gel and further purified(Fig.1). The modified TEV insertion were first digested with the restriction enzymes(BamH1 and Xho1)and so did the pET29a vector. (We digested the insertion and vector one by one because the amount of DNA decreased significantly after the digestions on our first double digestion, and we assumed that this is the result of star effect.)
Fig.1 1.8% gel of pSB1C3-BBa_K1319004 overhang PCR and DNA purification
Fig.2 0.8% gel of pET29a digestion(the 3kb is from the original insert of the vector)
After digestion, we ligated the plasmid and the TEV insert using the T4 ligase. This sample was then transformed in E.coli DH5α for colony PCR(using primer-T7 promoter and terminator) to confirm that we have successfully inserted the TEV protease sequence into pET29a(Fig.2).The sequence of two colony with the cloned part was confirmed from sequencing results. All the bases of the cloned part were confirmed to be correct.
Fig.3 0.8% gel of colony PCR using primers T7 promoter and terminator for pET29a.
Well 1-15:pET29a-TEV insert plasmid.
Well 16: control-pET29a with original insertion.
Experimental Data
Cultivations and Induction of protein expression
For small scale production, the plasmid was transformed into E.coli BL21(DE3), pET29b was also transformed and inducted as a negative control. We did SDS PAGE electrophoresis for our small scale production results. Good expression can be clearly seen in both lane 3(without induction by adding IPTG) and 4, indicating obvious leakage.
Fig.4 SDS PAGE for TEV Protease small scale production.
Protein solubility analysis
To further characterize the solubility of this part, after large scale production we then sonicated the culture and did 8700G and 16,000G centrifugation. We then did SDS-PAGE for coomassie brilliant blue staining and western blot to detect the content of our protein(Fig.5). In Fig.5, there was more “8700G P” group when compared with the “8700G S” group. This result meant that most proteins were deposited in the cell pellet after 8700G centrifugation because they are expressed as insoluble forms. Thus, minimal amount of TEV protease could be extracted from the cell lysate.
Fig.5 T meant the initial sample obtained after sonication; 8700G P and 8700G S meant the pellet and the supernatant obtained after 8700G for 20 min; 8700G S and 16,000G T meant the pellet and the supernatant gotten after 8700G for 20 min.
Purification and Dialysis
After extracting the cell lysates, we used nickel-resin column to purify our target proteins from the cell lysates because all of our proteins were tagged with 6 histidines fusion at their C-terminal ends with the pET29a plasmid. After protein purification, protein dialysis with PBS buffer to remove imidazole in our purified proteins, we did SDS-PAGE gel electrophoresis to ensure our target proteins were purified. However, after various troubleshooting, the results still shown poor yield of TEV protease most likely because of its insolubility. Expression with fusion proteins would be a possible way to obtain higher proportions.
Protein Expression overtime
We transformed the plasmids that contained this part into competent cell E.coli BL21. After cultured overnight, measure the ABS600 and diluting the LB medium to O.D.=0.1. Then incubated at 37℃, 150 rpm until the O.D. of the samples reached 0.4 to 0.6 . Add IPTG( final concentration : 0.4mM ) to 125 ml flask and another without adding IPTG as control, and then return to 37°C. From then on, after measure the O.D. values, transfer 1 ml from the induced sample and centrifuge at maximum speed for 60 seconds at RT and remove supernatant at 0, 0.5, 1.0, 1.5, 2.0 ,2.5 , 3.0, 3.5, 4 , 5, 6hours. Then we use SDS PAGE to analyze the quantity of TEV protease at each time spot.
Fig.6 The growth curve of BL21 induced by IPTG from 0 to 6 hours. The concentration of BL21 reached stationary phase at 2.5 hours. Also, induction shows a significant effect on the growth rate of E.coli BL21 carrying TEV-pET29a.
Fig.7a SDS-PAGE coomassie brilliant blue staining of TEV-pET29a induction.
Fig.7b Quantification of protein expressed overtime.
Though the amount of TEV protease (28kDa) increased consistently with time, we could not jump to conclusions that it was proper to incubate E.coli as long as possible. Another consideration was the time it would take. Just as we expected, it growed fast at the first 2.5 hours. That’s why we also chose 2.5hr after induced by IPTG when we extracted it from total cell lysates.