Oliver0423 (Talk | contribs) |
Oliver0423 (Talk | contribs) |
||
Line 3: | Line 3: | ||
<html> | <html> | ||
<style type="text/css"> | <style type="text/css"> | ||
− | .figure p{ | + | .figure p { |
− | + | font-size: 11px !important; | |
} | } | ||
+ | |||
/************************************************************************ | /************************************************************************ | ||
Tables | Tables | ||
Line 107: | Line 108: | ||
<!------------CONTENEDOR PRINCIPAL ----------------------------------------------------------------------------------------------------------------------------------> | <!------------CONTENEDOR PRINCIPAL ----------------------------------------------------------------------------------------------------------------------------------> | ||
<div class="main-container"> | <div class="main-container"> | ||
− | <section style="background-size: 100%;height: | + | <section style="background-size: 100%;height:95%;margin-top: 0em;padding-top: 1.1em;" class="height-90 parallax"> |
<div class="main-container" style="height: 100%;"> | <div class="main-container" style="height: 100%;"> | ||
<center style="height: 100%;"> | <center style="height: 100%;"> | ||
<div class="col-md-12" style="height: 100%;margin-top:2em; padding:0px"> | <div class="col-md-12" style="height: 100%;margin-top:2em; padding:0px"> | ||
− | <div id="logoPrinteria" class="item" style="background-image: url(https://static.igem.org/mediawiki/2019/ | + | <div id="logoPrinteria" class="item" style="background-image: url(https://static.igem.org/mediawiki/2019/f/f2/T--CSMU_Taiwan--cover_part.jpeg);height: 100%; width: 100%;background-attachment: fixed;background-size: cover;"> |
<img src="https://static.igem.org/mediawiki/2019/0/04/T--CSMU_Taiwan--charcterization.png" style=" margin-top: 0px;"> | <img src="https://static.igem.org/mediawiki/2019/0/04/T--CSMU_Taiwan--charcterization.png" style=" margin-top: 0px;"> | ||
− | |||
− | |||
− | |||
</div> | </div> | ||
</div> | </div> | ||
Line 130: | Line 128: | ||
<h1>Abstract</h1> | <h1>Abstract</h1> | ||
<p> The characterization of <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319004">BBa_K1319004</a> was carried out. This part is a TEV protease (also known as Tobaco Edge Virus nuclear inclusion a endopeptidase) that was optimized for expression in E. coli. The part contains the S219V anti-self cleavage mutation. | <p> The characterization of <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319004">BBa_K1319004</a> was carried out. This part is a TEV protease (also known as Tobaco Edge Virus nuclear inclusion a endopeptidase) that was optimized for expression in E. coli. The part contains the S219V anti-self cleavage mutation. | ||
− | The TEV Protease is a highly sequence specific cysteine protease from the Tobacco Edge Virus (TEV). The protease is highly sequence specific. The consensus sequence for the cut is ENLYFQ\S with \ denoting the cleaved peptide bond. This sequence can be found in the part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319016">BBa_K1319016</a>. Because of its stringent sequence specificity, tobacco etch virus (TEV) protease emerges as a useful reagent with wide application in the cleavage of recombinant fusion proteins. Thus, we have chosen TEV protease(sequence from BBa_K1319004) to remove the fusion protein in our another part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2951008">BBa_K2951008</a> and be characterized. | + | The TEV Protease is a highly sequence specific cysteine protease from the Tobacco Edge Virus (TEV). The protease is highly sequence specific. The consensus sequence for the cut is ENLYFQ\S with \ denoting the cleaved peptide bond. This sequence can be found in the part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319016">BBa_K1319016</a>. Because of its stringent sequence specificity, tobacco etch virus (TEV) protease emerges as a useful reagent with wide application in the cleavage of recombinant fusion proteins. Thus, we have chosen TEV protease(sequence from BBa_K1319004) to remove the fusion protein in our another part <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2951008">BBa_K2951008</a> and be characterized. |
− | </p> | + | </p> |
− | + | <h2>Cloning<h2> | |
− | + | <p>After obtaining TEV protease sequence in pSB1C3 from iGEM 2019 distribution kit(plate 6 21N), transforming it into DH5αand plasmid miniprep, we obtained the amount of plasmids required for construction. To characterize the TEV protease, the chosen vector for expression is pET29a which includes a 6xHis-Tag fusion on the plasmid following the insert. At both anchors at the N- and C-terminus the restriction sites for BamHI and XhoI were introduced to clone the genes into a pET29a vector by PCR with overhang primers primer1(TEV-fwd) and primer2(TEV-rev), the PCR result is observed by running a 1.8% gel and further purified(Fig.1). The modified TEV insertion were first digested with the restriction enzymes(BamH1 and Xho1)and so was the pET29a vector. (Fig.2)</p> | |
− | <table> | + | <table> |
− | + | <tbody> | |
− | + | <tr> | |
− | + | <th style="width:25%">Name</th> | |
− | + | <th>5'-3' primers sequences</th> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td>TEV-fwd</td> | |
− | + | <td>AATTGCGGATCCGGCGAAAGCCTGTTCAAAGGTC</td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td>TEV-rev</td> | |
− | + | <td>AATTGCCTCGAGACCACCTTGGGAGTAGACCAGTTCATTC</td> | |
− | + | </tr> | |
− | + | </tbody> | |
− | + | </table> | |
− | + | <div class="row figure"> | |
− | + | <div class="col-6"> | |
− | + | <img src="https://static.igem.org/mediawiki/2019/d/d8/T--CSMU_Taiwan--improve7.png" style="width:200px; text-align: center;"> | |
− | + | <p>Fig.1 1.8% gel of pSB1C3-BBa_K1319004 overhang PCR and DNA purification</p> | |
− | + | </div> | |
− | + | <div class="col-6"> | |
− | + | <img src="https://static.igem.org/mediawiki/2019/0/0e/T--CSMU_Taiwan--improve0.jpeg" style="width:200px; text-align: center;"> | |
− | </div> | + | <p>Fig.2 0.8% gel of pET29a digestion(the 3kb is from the original insert of the vector)</p> |
− | + | </div> | |
− | <p>After digestion, we ligated the plasmid and the TEV insert using the T4 ligase. This plasmid was then transformed in E.coli DH5α for colony PCR(using primer-T7 promoter and terminator) to confirm we have successfully inserted the TEV protease sequence into pET29a(Fig.3).<br> | + | </div> |
− | + | <p>After digestion, we ligated the plasmid and the TEV insert using the T4 ligase. This plasmid was then transformed in E.coli DH5α for colony PCR(using primer-T7 promoter and terminator) to confirm we have successfully inserted the TEV protease sequence into pET29a(Fig.3).<br> | |
− | + | <img src="https://static.igem.org/mediawiki/2019/7/74/T--CSMU_Taiwan--Characterization_Fig3.jpeg" style="width:400px; text-align: center;"> | |
− | + | <br> | |
− | Well 1-15:pET29a-TEV insert plasmid.<br> | + | <p>Fig.3 0.8% gel of colony PCR using primers T7 promoter and terminator for pET29a.<br> |
− | Well 16: control-pET29a with original insertion.<br></p> | + | Well 1-15:pET29a-TEV insert plasmid.<br> |
− | </p> | + | Well 16: control-pET29a with original insertion.<br></p> |
− | <h2>Small Scale Production<h2> | + | </p> |
− | <h3>Cultivations and Induction of protein expression<h3> | + | <h2>Small Scale Production<h2> |
− | <p>For small scale production, the plasmid was transformed into E.coli BL21. 1 colony from the transformation plates were inoculated in 10 ml LB-kanamycin (50 μg/ml working concentration) and grew the cells at +37 °C, 150rpm(tilted) in an incubator for 12-18hrs. 1cc was taken out to centrifuge and added 20ml of LB-kanamycin (50 μg/ml) to make the OD value~0.1. After incubation for another 2 hrs, it reached the OD595 value ~0.5. When finished growing the cells, the 20ml was separated into two tubes, and one of them was induced to express the gene of interest by adding a final concentration of 0,5 mM IPTG in the cultures and continued to grow at +37 °C shaking for 2.5hrs.</p> | + | <h3>Cultivations and Induction of protein expression<h3> |
− | <h2>Large scale production<h2> | + | <p>For small scale production, the plasmid was transformed into E.coli BL21. 1 colony from the transformation plates were inoculated in 10 ml LB-kanamycin (50 μg/ml working concentration) and grew the cells at +37 °C, 150rpm(tilted) in an incubator for 12-18hrs. 1cc was taken out to centrifuge and added 20ml of LB-kanamycin (50 μg/ml) to make the OD value~0.1. After incubation for another 2 hrs, it reached the OD595 value ~0.5. When finished growing the cells, the 20ml was separated into two tubes, and one of them was induced to express the gene of interest by adding a final concentration of 0,5 mM IPTG in the cultures and continued to grow at +37 °C shaking for 2.5hrs.</p> |
− | <h3>Cultivations and Induction of protein expression<h3> | + | <h2>Large scale production<h2> |
− | <h3>Protein solubility analysis<h3> | + | <h3>Cultivations and Induction of protein expression<h3> |
− | <h2>Purification and Dialysis<h2> | + | <h3>Protein solubility analysis<h3> |
− | <h2>Enzyme activity assay<h2> | + | <h2>Purification and Dialysis<h2> |
− | + | <h2>Enzyme activity assay<h2> | |
</div> | </div> | ||
</div> | </div> | ||
Line 196: | Line 194: | ||
}); | }); | ||
</script> | </script> | ||
− | |||
</body> | </body> | ||
</html> | </html> | ||
{{CSMU Taiwan/footer}} | {{CSMU Taiwan/footer}} |
Revision as of 09:03, 20 October 2019
Abstract
The characterization of BBa_K1319004 was carried out. This part is a TEV protease (also known as Tobaco Edge Virus nuclear inclusion a endopeptidase) that was optimized for expression in E. coli. The part contains the S219V anti-self cleavage mutation. The TEV Protease is a highly sequence specific cysteine protease from the Tobacco Edge Virus (TEV). The protease is highly sequence specific. The consensus sequence for the cut is ENLYFQ\S with \ denoting the cleaved peptide bond. This sequence can be found in the part BBa_K1319016. Because of its stringent sequence specificity, tobacco etch virus (TEV) protease emerges as a useful reagent with wide application in the cleavage of recombinant fusion proteins. Thus, we have chosen TEV protease(sequence from BBa_K1319004) to remove the fusion protein in our another part BBa_K2951008 and be characterized.
Cloning
After obtaining TEV protease sequence in pSB1C3 from iGEM 2019 distribution kit(plate 6 21N), transforming it into DH5αand plasmid miniprep, we obtained the amount of plasmids required for construction. To characterize the TEV protease, the chosen vector for expression is pET29a which includes a 6xHis-Tag fusion on the plasmid following the insert. At both anchors at the N- and C-terminus the restriction sites for BamHI and XhoI were introduced to clone the genes into a pET29a vector by PCR with overhang primers primer1(TEV-fwd) and primer2(TEV-rev), the PCR result is observed by running a 1.8% gel and further purified(Fig.1). The modified TEV insertion were first digested with the restriction enzymes(BamH1 and Xho1)and so was the pET29a vector. (Fig.2)
Name | 5'-3' primers sequences |
---|---|
TEV-fwd | AATTGCGGATCCGGCGAAAGCCTGTTCAAAGGTC |
TEV-rev | AATTGCCTCGAGACCACCTTGGGAGTAGACCAGTTCATTC |
Fig.1 1.8% gel of pSB1C3-BBa_K1319004 overhang PCR and DNA purification
Fig.2 0.8% gel of pET29a digestion(the 3kb is from the original insert of the vector)
After digestion, we ligated the plasmid and the TEV insert using the T4 ligase. This plasmid was then transformed in E.coli DH5α for colony PCR(using primer-T7 promoter and terminator) to confirm we have successfully inserted the TEV protease sequence into pET29a(Fig.3).
Fig.3 0.8% gel of colony PCR using primers T7 promoter and terminator for pET29a.
Well 1-15:pET29a-TEV insert plasmid.
Well 16: control-pET29a with original insertion.
Small Scale Production
Cultivations and Induction of protein expression
Cultivations and Induction of protein expression
For small scale production, the plasmid was transformed into E.coli BL21. 1 colony from the transformation plates were inoculated in 10 ml LB-kanamycin (50 μg/ml working concentration) and grew the cells at +37 °C, 150rpm(tilted) in an incubator for 12-18hrs. 1cc was taken out to centrifuge and added 20ml of LB-kanamycin (50 μg/ml) to make the OD value~0.1. After incubation for another 2 hrs, it reached the OD595 value ~0.5. When finished growing the cells, the 20ml was separated into two tubes, and one of them was induced to express the gene of interest by adding a final concentration of 0,5 mM IPTG in the cultures and continued to grow at +37 °C shaking for 2.5hrs.