Difference between revisions of "Team:CSMU Taiwan/Improve"

Sequence selection and Codon Optimization

The previous part (BBa_K1955000) was documented to be acquired from NCBI with no further indication. The sequence of HA strain(A/WSN 1933/TS61(H1N1)) is based on NCBI(CY010788.1), being 7 bp difference to the precious part(Fig.1).

To express the target protein, we chosed to use BL21 E.coli strain with a pET29a vector. In order to improve the expression efficiency of our chassis, we first codon optimized the sequence and checked for illegal cutting sites using ATGme for E.coli.

Figure 1. Sequence alignment of NCBI(CY010788.1) AND BBa_K1955000 protein coding part. The 7bp difference is indicated by color yellow.

Improved Solubility

First, we analyzed the transmembrane domain of HA using TMHMM Server (Fig.2) to delete its coding sequence and the four hydrophobic amino acids’ in front, which is a total of 35 a.a. .

Fig.2 Transmembrane domain of analyzed by TMHMM

Second, we added a novel fusion partner to promote its folding and solubility--Escherichia coli (E. coli) lysyl tRNA synthetase (LysRS), whose coding sequence was obtained from NCBI (NC_000913.3). The sequence is also optimized and checked for illegal restriction sites.

TEV Cutting site

Considering that our expressed HA will be used as a target protein for further aptamer selection with SELEX, the removal of the protein generated from LysRS is needed. Thus, we added a TEV protease cutting site (GAAAACCTGTATTTTCAGGGC) obtained from BBa_K1319016 between the coding sequence of LysRS and HA.

Further Applications

Adding the histidine tag creates the opportunity to use a simpler method of purification, as well as increase selectivity for the desired protein, which is necessary for the next step of SELEX after expression.

Furthermore, with a view to construct a plasmid as a ready-made vector for high yield soluble different HA subtypes, we designed a polylinker(Fig.3) between LysRS and HA.

Experimental Data

The previous part BBa_K1955000 and this part BBa_K2951008 as an improvement, was inserted into pET29a vector. They were transformed into E.coli BL21(DE3) strain to express our proteins. pET29b was also transformed into BL21 and followed the induction protocol as negative control.Our expression system is inducible with addition of IPTG to expression culture. Small and large scale production was first done to confirm that we have successfully express the target protein needed in our project-hemagglutinin(Fig.3).

Fig.3 SDS-PAGE coomassie blue staining for small scale production of pET29a, LysRS-HA and BBa_K1955000.

Protein solubility analysis

To further characterize the solubility of this part, we then sonicated the culture and did 8700G and 16,000G centrifugation. In Fig. 4, we could find there was better expression than BBa_K1955000 since the latter result could not be observed by SDS-PAGE(data not shown). In Fig. 3b(I), there was more “16000 G S” group when compared with the “16000G P” group. This result meant that most proteins were dissolved in the supernatant while few proteins deposited in the cell pellet after 16000G centrifugation. However, we infered that BBa_K1955000 does not have good solubility since many proportions of it is in “8700G P”.

Fig.4 SDS-PAGE coomassie blue staining for large scale production. T meant the initial sample obtained after sonication; 8700G P and 8700G S meant the pellet and the supernatant obtained after 8700G for 20 min; 8700G S and 16,000G T meant the pellet and the supernatant gotten after 8700G for 20 min.

Fig.5 Western Blotting for large scale production (I)LysRS-HA (II)BBa_K1955000.

Protein purification and dialysis

We used nickel-resin column to purify our target proteins from the cell lysates, protein dialysis with PBS buffer to remove imidazole in our purified proteins and SDS-PAGE gel electrophoresis to ensure our target proteins were purified.

Fig.6 SDS-PAGE of LysRS-HA purification result

For detailed experiment conditions and method, please check out our documentation on Part’s main page(linked in absract)!

Reference

1.Yo Han Jang, Seung HeeCho, Ahyun Son, Yun Ha Lee, Jin hee Lee, Kwang-Hee Lee, Baik Lin Seong, High-yield soluble expression of recombinant influenza virus antigens from Escherichia coli and their potential uses in diagnosis, Journal of Virological Methods,Volume 196, February 2014, Pages 56-64 (https://doi.org/10.1016/j.jviromet.2013.10.035)