Difference between revisions of "Team:CSMU Taiwan/Improve"
Sa10940134 (Talk | contribs) |
|||
| Line 345: | Line 345: | ||
<p>Adding the histidine tag creates the opportunity to use a simpler method of purification, as well as increase selectivity for the desired protein, which is necessary for the next step of SELEX after expression. </p> | <p>Adding the histidine tag creates the opportunity to use a simpler method of purification, as well as increase selectivity for the desired protein, which is necessary for the next step of SELEX after expression. </p> | ||
<p>Furthermore, with a view to construct a plasmid as a ready-made vector for high yield soluble different HA subtypes, we designed a polylinker(Fig.3) between LysRS and HA. </p> | <p>Furthermore, with a view to construct a plasmid as a ready-made vector for high yield soluble different HA subtypes, we designed a polylinker(Fig.3) between LysRS and HA. </p> | ||
| − | <img src="https://2019.igem.org/File:T--CSMU_Taiwan--improve1.png" alt=""text" | + | <img src="https://2019.igem.org/File:T--CSMU_Taiwan--improve1.png" alt=""text"; "width: 50%; height: auto;"> |
<h3>Experimental Data</h3> | <h3>Experimental Data</h3> | ||
<p>This year, we aim to develop a rapid screening kit for influenza. To enable the kit to become a tool to further obtain more detailed epidemiology statistics for better measures of prevention. Thus, one of the aspects of our project is to distinguish between the subtypes of influenza with Hemagglutinin (HA). To select aptamers against HA, expression of a certain amount is needed. However, the lack of general technical platform for the timely supply of soluble and highly purified influenza HA presents a bottleneck for the subsequent analysis for the effective control of the viral disease. </p> | <p>This year, we aim to develop a rapid screening kit for influenza. To enable the kit to become a tool to further obtain more detailed epidemiology statistics for better measures of prevention. Thus, one of the aspects of our project is to distinguish between the subtypes of influenza with Hemagglutinin (HA). To select aptamers against HA, expression of a certain amount is needed. However, the lack of general technical platform for the timely supply of soluble and highly purified influenza HA presents a bottleneck for the subsequent analysis for the effective control of the viral disease. </p> | ||
Revision as of 16:35, 16 October 2019
Sequence Optimization
TEV Cutting Site
Further Applications
Improved Solubility
header
Sequence selection and Codon Optimization
The previous part (BBa_K1955000) was documented to be acquired from NCBI with no further indication. The sequence of HA strain(A/WSN 1933/TS61(H1N1)) is based on NCBI(CY010788.1), being 7 bp difference to the precious part(Fig.1).
To express the target protein, we chose to use BL21 E.coli strain with a pET29a vector. In order to improve the expression efficiency of our chassis, we first codon optimized the sequence and checked for illegal cutting sites using ATGme for E.coli.
Figure 1. Sequence alignment of NCBI(CY010788.1) AND BBa_K1955000 protein coding part. The 7bp difference is indicated by color yellow.
Improved Solubility
First, we analyzed the transmembrane domain of HA using TMHMM Server (Fig.2) to delete its coding sequence and the four hydrophobic amino acids’ in front, which is a total of 35 a.a. .
Fig.2 Transmembrane domain of analyzed by TMHMM
Second, we added a novel fusion partner to promote its folding and solubility--Escherichia coli (E. coli) lysyl tRNA synthetase (LysRS), whose coding sequence was obtained from NCBI (NC_000913.3). The sequence is also optimized and checked for illegal restriction sites.
TEV Cutting site
Considering that our expressed HA will be used as a target protein for further aptamer selection with SELEX, the removal of the protein generated from LysRS is needed. Thus, we added a TEV protease cutting site (GAAAACCTGTATTTTCAGGGC) obtained from BBa_K1319016 between the coding sequence of LysRS and HA.
Further Applications
Adding the histidine tag creates the opportunity to use a simpler method of purification, as well as increase selectivity for the desired protein, which is necessary for the next step of SELEX after expression.
Furthermore, with a view to construct a plasmid as a ready-made vector for high yield soluble different HA subtypes, we designed a polylinker(Fig.3) between LysRS and HA.
Experimental Data
This year, we aim to develop a rapid screening kit for influenza. To enable the kit to become a tool to further obtain more detailed epidemiology statistics for better measures of prevention. Thus, one of the aspects of our project is to distinguish between the subtypes of influenza with Hemagglutinin (HA). To select aptamers against HA, expression of a certain amount is needed. However, the lack of general technical platform for the timely supply of soluble and highly purified influenza HA presents a bottleneck for the subsequent analysis for the effective control of the viral disease.
Reference
1.Yo Han Jang, Seung HeeCho, Ahyun Son, Yun Ha Lee, Jin hee Lee, Kwang-Hee Lee, Baik Lin Seong, High-yield soluble expression of recombinant influenza virus antigens from Escherichia coli and their potential uses in diagnosis, Journal of Virological Methods,Volume 196, February 2014, Pages 56-64 (https://doi.org/10.1016/j.jviromet.2013.10.035)