Abstract

The characterization of BBa_K1319004 was carried out. This part is a TEV protease (also known as Tobaco Edge Virus nuclear inclusion a endopeptidase) that was optimized for expression in E. coli. The part contains the S219V anti-self cleavage mutation. The TEV Protease is a highly sequence specific cysteine protease from the Tobacco Edge Virus (TEV). The protease is highly sequence specific. The consensus sequence for the cut is ENLYFQ\S with \ denoting the cleaved peptide bond. This sequence can be found in the part BBa_K1319016. Because of its stringent sequence specificity, tobacco etch virus (TEV) protease emerges as a useful reagent with wide application in the cleavage of recombinant fusion proteins. Thus, we have chosen TEV protease(sequence from BBa_K1319004) to remove the fusion protein in our another part BBa_K2951008 and be characterized.

Cloning

After obtaining TEV protease sequence in pSB1C3 from iGEM 2019 distribution kit(plate 6 21N), transforming it into DH5αand plasmid miniprep, we obtained the amount of plasmids required for construction. To characterize the TEV protease, the chosen vector for expression is pET29a which includes a 6xHis-Tag fusion on the plasmid following the insert. At both anchors at the N- and C-terminus the restriction sites for BamHI and XhoI were introduced to clone the genes into a pET29a vector by PCR with overhang primers primer1(TEV-fwd) and primer2(TEV-rev), the PCR result is observed by running a 1.8% gel and further purified(Fig.1). The modified TEV insertion were first digested with the restriction enzymes(BamH1 and Xho1)and so was the pET29a vector. (Fig.2)

Name	5'-3' primers sequences
TEV-fwd	AATTGCGGATCCGGCGAAAGCCTGTTCAAAGGTC
TEV-rev	AATTGCCTCGAGACCACCTTGGGAGTAGACCAGTTCATTC

Fig.1 1.8% gel of pSB1C3-BBa_K1319004 overhang PCR and DNA purification

Fig.2 0.8% gel of pET29a digestion(the 3kb is from the original insert of the vector)

After digestion, we ligated the plasmid and the TEV insert using the T4 ligase. This plasmid was then transformed in E.coli DH5α for colony PCR(using primer-T7 promoter and terminator) to confirm we have successfully inserted the TEV protease sequence into pET29a(Fig.3).

Fig.2 0.8% gel of colony PCR using primers T7 promoter and terminator for pET29a.
Well 1-15:pET29a-TEV insert plasmid.
Well 16: control-pET29a with original insertion.