Abstract

The characterization of BBa_K1319004 was carried out. This part is a TEV protease (also known as Tobaco Edge Virus nuclear inclusion a endopeptidase) that was optimized for expression in E. coli. The part contains the S219V anti-self cleavage mutation. The TEV Protease is a highly sequence specific cysteine protease from the Tobacco Edge Virus (TEV). The protease is highly sequence specific. The consensus sequence for the cut is ENLYFQ\S with \ denoting the cleaved peptide bond. This sequence can be found in the part BBa_K1319016. Because of its stringent sequence specificity, tobacco etch virus (TEV) protease emerges as a useful reagent with wide application in the cleavage of recombinant fusion proteins. Thus, we have chosen TEV protease(sequence from BBa_K1319004) to remove the fusion protein in our another part BBa_K2951008 and be characterized.

Cloning

After obtaining TEV protease sequence in pSB1C3 from iGEM 2019 distribution kit(plate 6 21N), transforming it into DH5αand plasmid miniprep, we obtained the amount of plasmids required for construction. To characterize the TEV protease, the chosen vector for expression is pET29a which includes a 6xHis-Tag fusion on the plasmid following the insert. At both anchors at the N- and C-terminus the restriction sites for BamHI and XhoI were introduced to clone the genes into a pET29a vector by PCR with overhang primers primer1(TEV-fwd) and primer2(TEV-rev), the PCR result is observed by running a 1.8% gel and further purified(Fig.1). The modified TEV insertion were first digested with the restriction enzymes(BamH1 and Xho1)and so was the pET29a vector. (Fig.2)

Name	5'-3' primers sequences
TEV-fwd	AATTGCGGATCCGGCGAAAGCCTGTTCAAAGGTC
TEV-rev	AATTGCCTCGAGACCACCTTGGGAGTAGACCAGTTCATTC