Team:Tunghai TAPG/Wetlab/Protocol

TeamPage

Protocol

Making and Running Agarose Gels

1.Add the TAE buffer.

2. Add the agarose powder with a volume to the mass ratio of X % and add it into the buffer.

3. The mixture is heated several times in a microwave oven until the solution becomes clear.

4. Cool the solution to about 40-50°C and add the nucleic acid dye.

5. Place the appropriate comb on the gel tray and pour the solution into the tray gel and allow the gel to cool until it becomes hard.

6. Carefully pull out the comb, do not damage the glue hole, take the gel into the electrophoresis room.

8. Add enough TAE buffer to make it no gel.

9. Take the appropriate amount of the loading buffer and the DNA (Gene Finder) mixed DNA sample into the pores of the gel; take the appropriate amount of marker into the gel pore as a control.

10. Run the gel at 100V, for 60 minutes.

Table.1. correct percent agarose gel concentration for resolving DNA fragments.

Percent Agarose gel (w/v)	DNA size resolution (bp)
0.5 %	2000-50000
0.6 %	1000-20000
0.7 %	800-12000
0.8 %	800-10000
0.9 %	600-10000
1.0 %	400-8000
1.5 %	200-3000
2.0 %	100-2000
3.0 %	25-1000
4.0 %	10-500
5.0 %	10-300

Making Agar Plates

1. Prepare LB-Agar for autoclave: 10 g tryptone, 5 g yeast extract and 5 g of NaCl per litre.

2. Autoclave. If it is still molten when collected, it can be left in a 60°C water bath to cool down for poouring. Otherwise, if it has solidified, it needs to be microwaved until molten, then left in a 60°C water bath to cool to the correct temperature.

3. Once agar is molten, mix carefully. Add antibiotics and any other desired additives.

4. Pour plates carefully.

5. Allow to set for approximately 10 min.

6. Invert plates and allow to dry for 20-30 min.

7. Store plates at 4°C

eGFP

1. Prepare master mix

Components (50μl) Volume(μl)

10X Tag Buffer 5

dNTPs (10 mM) 2.5

Template 1

Primer-F 2.5

Primer-R 2.5

Tag DNA Polymerase 1

ddH₂0 35.5

2.Transfer tube to a thermocycler with the following program.

Step Temperature(℃) Time(s)

initial denaturing 95 300

10 cycles 95 30

10 cycles 52 30

10 cycles 72 30

30 cycles 72 30

30 cycles 60.5 30

30 cycles 72 30

extension 72 420

Sec VMA intein

1. Prepare master mix

Components (50μl) Volume(μl)

10X Tag Buffer 5

dNTPs (10 mM) 2.5

Template 1

Primer-F 2.5

Primer-R 2.5

Tag DNA Polymerase 1

ddH₂0 35.5

2.Transfer tube to a thermocycler with the following program.

Step Temperature(℃) Time(s)

initial denaturing 95 300

10 cycles 95 30

10 cycles 52 30

10 cycles 72 30

30 cycles 72 30

30 cycles 58.5 30

30 cycles 72 30

extension 72 420

Hold 4 forever

SUMO

1. Prepare master mix

Components (50μl) Volume(μl)

10X Tag Buffer 5

dNTPs (10 mM) 2.5

Template 1

Primer-F 2.5

Primer-R 2.5

Tag DNA Polymerase 1

ddH₂0 35.5

2.Transfer tube to a thermocycler with the following program.

Step Temperature(℃) Time(s)

initial denaturing 95 300

10 cycles 95 30

10 cycles 52 30

10 cycles 72 30

30 cycles 72 30

30 cycles 60.8 30

30 cycles 72 30

extension 72 420

Hold 4 forever

PCR Amplification

Sequence of primer

Primer Length

Forward AAATGGCTGCGTTGGGTCCGCCGCC 25mer

Reverse CCACCAACGGCGGCGGACCCAACGCAG 27mer

1. Prepare master mix

Components (50μl) Volume(μl)

10X Tag Buffer 5

dNTPs (10 mM) 5

Primer-F 5

Primer-R 5

Tag DNA Polymerase 1

ddH₂0 29

2.Transfer tube to a thermocycler with the following program.

Step Temperature(℃) Time(s)

initial denaturing 94 300

30 cycles 94 30

30 cycles 59 30

30 cycles 70 30

extension 72 300

Hold 4 forever

Overlap Extension PCR:

(TAPG)

1. Prepare master mix

Components (50μl) Volume(μl)

10X Tag Buffer 5

dNTPs (10 mM) 2.5

DNA　Template 1

Primer-F 2.5

Primer-R 2.5

Tag Polymerase 1

ddH₂0 35.5

2.Transfer tube to a thermocycler with the following program.

Step Temperature(℃) Time(s)

initial denaturing 95 300

10 cycles 95 30

10 cycles 50 30

10 cycles 72 30

30 cycles 72 30

30 cycles 60.8 30

30 cycles 72 30

extension 72 420

Hold 4 forever

Overlap Extension PCR:

1. Prepare master mix

Components (50μl) Volume(μl)

10X Tag Buffer 5

dNTPs (10 mM) 5

DNA Template 1

Primer-F 2.5

Primer-R 2.5

Tag Polymerase 1

ddH₂0 33

2.Transfer tube to a thermocycler with the following program.

Step Temperature(℃) Time(s)

initial denaturing 94 300

10 cycles 94 30

10 cycles 50 30

10 cycles 72 30

30 cycles 94 30

30 cycles 59 30

30 cycles 70 30

extension 72 300

Hold 4 forever

PCR(check)

1. Prepare master mix

Components (50μl) Volume(μl)

10X Tag Buffer 5

dNTPs (10 mM) 1

DNA Template 1

Primer-F 1

Primer-R 1

Tag Polymerase 1

ddH₂0 40

2.Transfer tube to a thermocycler with the following program.

Step Temperature(℃) Time(s)

initial denaturing 94 300

30 cycles 94 30

30 cycles 51 30

30 cycles 70 30

extension 72 300

Hold 4 forever

Colony PCR

1. Prepare master mix

Components (50μl) Volume(μl)

10X Tag Buffer 5

Insert Fragment 1

Backbone Fragment 20

T7 DNA ligase 1

Bsa I –HFv2 1

ddH₂O 22

Ligation

2.Incubate ligations at 4°C overnight

3.Transform into chemically competent E. coli by heat shock

Golden Gate Assembly

1. Prepare master mix

Components (50μl) Volume(μl)

Intein 1

SUMO 1

eGFP 1

6x His 1

T7 DNA ligase 1

Bsa I –HFv2 1

Tag DNA Polymerase 2.5
ddH₂O 16.5

2.Incubate ligations at 4°C overnight

3.Transform into chemically competent E. coli by heat shock

Heat Shock Transformation of Chemically Component E. coli.

1. Remove the loaded competent cells (DH5α, 100μl) from the -80°C refrigerator and insert into the ice immediately for 30 minutes.

2. Add 5μl of the ligation product and gently shake the ice for 30 min.

3. Gently shake into the 42 ℃ water bath heat shock 30-60s, quickly put back to the ice, standing for 5min.

4. Add 900μl of LB medium to the tube, mix gently and incubate at 37°C 200rmp for 1h.

5. Remove the coating rod from the alcohol, lit on the alcohol lamp, place it aside, take 100μl of the mixture, add to the LB plate containing antibiotics and apply evenly.

6. centrifuge at 11,000 g for 1 minute to pellet the remaining cells. Pour off the supernatant, resuspend the cells in the remaining liquid and plate out on selective LB.

7.Incubate plates at 37°C for a minimum of 12 hours for transformant colonies to appear.

PCR purification using QIAquick PCR purification kit.

1.1 vol sample 5 vol Binding Buffer(Mix completely)

2.Loading DNA Mixture(~700μl) onto column then Centrifuge it (12,000-14,000 g, 1 min)

3.Add 700μl Washing Buffer then centrifuge it (12,000-14,000 g, 1 min)

4.Discard the filtrate then centrifuge it(12,000-14,000 g, 3 min)

5.Dry the spin column and Incubate (37~65℃,5min)

6.Add 35~50μl Elution Buffer / ddH2O then centrifuge it(12,000-14,000 g, 1 min)

Isolation of plasmid in E.coli

1.Resuspend pelleted bacterial cells in 250μl Buffer P1 and transfer to a microcentrifuge tube.

2.Add 250μl Buffer P2 and mix thoroughly by inverting the tube 4-6times.(If using LyseBlue reagent, solution turns colorless.)

3.Add 350μl Buffer N3 and mix immediately and thoroughly by inverting the tube 4-6 times.(If using LyseBlue reagent, solution turns colorless.)

4.Centrifuge for 10min at 13,000rpm (~17,900 x g)in a table-top microcentrifuge.

5.Apply the supernatant (from step 4)to the QIAprep spin column by decanting or pipetting.

6.Centrifuge for 30-60 s. Discard the flow-through.

7.Recommended:Wash the QIAprep spin column by adding 0.5 ml Buffer PB and Centrifuge for 30-60 s. Discard the flow-through.(This step is only required when using endA* or other bacteria stains with high nuclease activity or carbohydrate content (see QIAprep Miniprep Handbook for more details

8.Wash QIAprep spin column by adding 0.75ml Buffer PE and centrifuging for 30-60 s.

9.Discard the flow-through,and centrifuge for an additional 1 min to remove residual wash buffer.

10.To elute DNA, place the QIAprep column in a clean 1.5ml microcentrifuge tube.Add 50μl Buffer EB or water to the center of each QIAprep spin column,let stand for 1 min, and centrifuge for 1 min.