DePet

Results

1. Cloning of Recombinant DNA for expressing PETase and MHETase E. coli

Figure 1. Part of agarose gel image used for DNA cloning in this project

Our basic parts were synthesized from Twist Bioscience and IDTDNA. When needed, the 5’-nucleotide of synthetic gene fragments were phosphorylated by T4 polynucleotide kinase. After that, they were inserted into the blunted plasmid. After selecting the positive clones with the use of restriction enzymes, these plasmids were finally sequenced. The genes used in this project were cut with NdeI and Xhol and were subcloned into the expression vectors.

2. Reporter gene Assay for light inducible promoter in E. coli

Figure 2. Light inducible expression of mScarlet in E. coli.

To overexpress the PET degrading enzymes in E. coli, we used two different expression systems. The first is the light inducible expression system, which was used by many iGem teams. To check whether the regulatory part was functioning properly under our testing conditions, we incubated E. coli BL21 with pDawn-mScarlet(BBa_K3288054) under white light in 37 degrees in a shaking incubator. This expression system successfully functioned without much issues in not only the Normal LB broth(pH6.6), but also the maximum activation pH of the PET degrading enzymes (8.5).

3. Reporter gene Assay for selection of constitutive promoter in E. coli

Figure 3. Constitutive expression of mSCarlet in E. coli.

Next, in order to express constitutively, we combined the following to check expression: J23119, constitutive strong promoter, and reporter gene. However, for an unknown reason, regulatory part did not function in our experiment condition (Figure 3B). Therefore, we fused 4 strong constitutive promoters that were chosen based on research papers and experiments - CP25(BBa_K1509003), CP44(BBa_K864511) , J23119(BBa_J23119) - with 3 strong ribosome binding sites - RBS, Cdog(ref), NO29(ref), Dawn(from pDawn)- and constructed 12 constitutive expression units (CEU)-mScarlet(BBa_K3288032, BBa_K3288033 BBa_K3288034, BBa_K3288035, BBa_K3288036, BBa_K3288037, BBa_K3288038, BBa_K3288039, BBa_K3288040, BBa_K3288041, BBa_K3288042, BBa_K3288043,) to create to create a new regulatory part. As it is shown in Figure 3A, CEU(pCEU03(BBa_K3288034), pCEU06(BBa_K3288037), pCEU09(BBa_K3288040), pCEU12(BBa_K3288043 that include RBS (Dawn;tttgtttaactttaagaaggaga), which originated from pDawn, had the highest expression rate regardless of the promoter. Furthermore, fluorescence was observed in pCEU04(BBa_K3288035), pCEU07(BBa_K3288038), pCEU11(BBa_K3288042). In order to quantify 12 pCEU activation, we sonicated overnight cultured E.coli and obtained whole lysate. We used Spectrophotometer to measure A280(total protein) of whole lysate and A569(excitation wavelength of mScarlet). Results showed that pCEU09 and pCEU12 have the high expression rates.

4. The finding optimal condition for pCEU12 promoter in E. coli

Figure 4. Expression of pCEU12-mScarlet in E. coli.

Among the 4 strong constitutive expression units that were checked in Figure 3, we used pCEU12 that did not disturb the growth of E.coli (data not shown) to check mScarlet expression in various conditions. Results showed that at 37℃, mScarlet expression rate decreased in LB(pH8.5), and after 12 hours of incubation, no mScarlet were observed at 25 and 30 degrees celsius, but after 24 hours or more incubation, we were able to observe mScarlet.

5. The expression of PETase and MHETase by two different promoters at low temperature and high pH conditions.

Figure 5. Production of PET degrading enzymes in low temp. and high pH condition.

Based on original research, when PET degrading enzymes are overexpressed at 37 degrees Celsius, they create insoluble aggregates(inclusion body) that cannot show enzyme activation. Therefore, they have to be expressed slowly in low temperature. We checked PET degrading enzyme expressions in low temperature conditions In two kinds of expression systems. In Figure 5A, our constitutive system could not produce PETase in low temperature condition. On the other hand, light inducible expression system was able to induce both PETase and MHEtase expressions. Therefore, we used light inducible expression system for every protein expression after that.

6. Prediction of secretion signal peptide fused PETase by SignalP.

Figure 6. Prediction of secretion signal fused PETase by SignalP.

According to previous research (Hogyun Seo et al. (2019), Ideonella sakaiensis’s PETase was not properly secreted into extracellular matrix of E.coli. In order to increase PET degradation enzyme secretion rate in E.coli, we researched and chose 2 secretion signal peptides(SPLamB, NSP4). In the research paper (Hogyun Seo et al. (2019), LamB’s signal peptide most effectively secreted PETase than other signal peptides(PelB, MalE, etc). The PETase used in the aforementioned research had removed 5 other amino acids (Q28TNPY32) in addition to predicted signal peptide(M1NFPRASRLMQAAVLGGLMAVSAAATA27). We included the 5 amino acids and again computed. Results showed that there is a higher probability of cleavage site and signal peptide likelihood than SPLamB-PETase(33-290). Novel signal peptide NSP4 that was reported in Soojin Han el al. (2017)’s research paper was attached to PETase(28-290), and when predicted, NSP4-PETase(28-290) was estimated to have a higher probability of secretion than SPLamB-PETase(28-290).

7. Prediction of secretion signal peptide fused PETase by SignalP.

Figure 7. Prediction of secretion signal fused PETase by SignalP.

In order to confirm the predicted data, we induced PETase that has each signal peptide attached with light at 18 °C for 24 hours. We centrifuges and removed E.coli, finally concentrating the media. We purified concentrated LB media with Nickel column and the purified proteins were analyzed with SDS-PAGE and immunoblot assay. As it is shown in Figure 7, SPLamB-PETase(28-290) was secreted 20% more, NSP4-PETase(28-290) was secreted 50% more than SPLamB-PETase(33-290).

8. Degradation of PET disc by extracellular PETase and MHETase.

Figure 8. Degradation of PET disc by extracellular PET degrading enzymes.

After PETase and MHETase was analyzed based on protein structures, some of them were reported to be point mutated with increased enzyme activation. Our team checked PETase wild type, W159H/S238F, and S121E/D186H/R280A’s PET degradation activities to choose enzymes for PET degrading device. These enzymes were produced at 18 °C in LB (buffered 50mM BTP (pH8.5) for 24 hours. After centrifuged, we put PET disc into cleared media with no E.coli and reacted it for 24 hours at 40 degrees Celsius. Everyday, we replaced media with ones that has new PET degrading enzyme secreted. After 5 days, we washed PET disc and dried it up to measure the change in weight. Results showed that NSP4-PETase (S121E/D186H/R280A) degraded the most PET.

Based on previous data, we constructed PET degrading device(DePET). DePET has two parts. For the first part, the temperature is kept at 18 degrees Celsius and LB media (50 mM BTP, pH 6.6) is used to produce PET degrading enzyme stably. For the second part, the temperature is kept at 40 °C and pH is kept at 8.5 to effectively degrade PET. We used NSP4-PETase(S121E/D186H/R280A) and NSP4-MHETase(W397A) as PET degrading enzyme.

9. Growth curve of engineered E. coli at 18 ℃.

Figure 9. E. coli growth curve at 18 ℃

Also, due to the fact that we needed to decide when to replace the media (for the automation of DePET), we had to first determine the growth curve of the E. coli under our expression conditions. As it can be seen in Figure 9, E. coli BL21 reaches a stationary phase at 18 °C after 24 hours. Also, PET degrading enzyme loses half of its activation after 24 hours at 40 degrees Celsius. Therefore, we set it up so enzyme production and PET degradation would circulate every 24 hours. After, we checked if PET disc is effectively degraded at DePET in this condition.

10. Degradation of PET by DePET (Prototype)

Figure 10. Degradation of PET by DePET.

First, PET disc were treated for 2 days at DePET. In order to find out about the change in PET disc’s surface, we used atomic force microscopy and obtained an image. As it is shown in Figure 10A, PET disc that was treated for 2 days in DePET had more hollow parts than negative control. In order to check whether DePET production and degradation circulation work properly, we drove the DePET for 20 days. In DePET, the weight of PET gradually decreased over time. These results indicate that the PET degradation function of DePET is operating normally (Figure 10B).

References

Han, S., Machhi, S., Berge, M., Xi, G., Linke, T., & Schoner, R. (2017). Novel signal peptides improve the secretion of recombinant Staphylococcus aureus Alpha toxin H35L in Escherichia coli. AMB Express, 7(1), 93.

Eckdahl, A. J., Neal, R., Campbell, A. M., & Eckdahl, T. T. (2017). rClone: a synthetic biology tool that enables the research of bacterial translation. Journal of Young Investigators, 32(3). Chen, J., Zhu, X., Tan, Z., Xu, H., Tang, J., Xiao, D., & Zhang, X. (2014). Activating C 4-dicarboxylate transporters DcuB and DcuC for improving succinate production. Applied microbiology and biotechnology, 98(5), 2197-2205.

Team:SIS Korea/Results