Team:PuiChing Macau/Results
Results
Laccase secretion from recombinant E.coli
Endocrine disrupting chemicals (EDC) are mostly man-made compound, which would be found in various daily materials such as pesticides, metals, additives or contaminants in food, and personal care products. It has been proposed by World Health Organization that EDCs would affect humans later in life and associated with an increased incidence of breast cancer, abnormal growth patterns and neurodevelopmental delays in children, as well as changes in immune function.
Laccases are copper-containing enzyme, which would be found in many plants, fungi, and microorganisms. Due to its function in oxidizing phenolic and nonphenolic aromatic compounds, Laccases are increasingly being used in different industries, including food, pulping, textile and wastewater treatment. Regarding EDCs, phenolic compounds have constituted a part of this family and previous studies have already demonstrated Laccase's ability in bioremediation such chemicals.
Current wastewater treatment technologies are yet to satisfy the need of EDCs removal. The secretion of Laccases would potentially improve the current treatment and increase. The present section focuses on the secretion of recombinant Laccases from engineered E.coli.
Overview
This study describes the construction and characterization of several new BioBricks, which will allow the future investigation of Laccases secretion by the SRP and Sec pathway, as the proposed mechanism of NSP4-Novel Signal Peptide 4. The findings of present studies suggest that our new Bio-Bricks are a success and would be expressed, and fully functional.
Background
The type II secretion pathway is a two-step process, which proteins are secreted out of the cell by periplasmic translocation. This is included the SecB-dependent (Sec), signal recognition particle (SRP), and twin-arginine translocation (TAT) pathways, and are commonly found in gram-negative bacteria. pelB and dsbA are sequences important to the Sec and SRP pathway. Through swapping individual domains of modifying dsbA and pelB signal peptides, a series of novel signal peptides were designed and demonstrated to have improved secretion efficiency in E. coli.
Aim
In this sub-project, we aim to improve Laccase production by introducing a inducible secretion system. We investigated the effect of the new Biobricks in dye decolorization and EDC degradation.
Result
1. Successful assembly of gene constructs
Lane 1: Invitrogen 1Kb plus DNA Ladder.
Lane 2: PCR product with T7 short and T7 term primers using K3021004_pET11a (NSP4_Lac1326_pET11a) as a template.
Lanes 3-8: PCR products with T7 short and T7 term primers using K3021002_pET11a (NSP4_K863030_pET11a) from different plasmids as templates.
Lanes 9: Negative control.
Figure 1 shows the agarose Gel electrophoresis of PCR. We first extracted DNA from the antibiotic-resistant clones, and then validation through PCR with T7 short and T7 term primers. The product of PCR in lane 2 shows a signal band at 1522 bp while products from lane 3 to 8 show a band at 1850 bp. The size match expected size of K3021004_pET11a (NSP4_Lac1326_pET11a_6xHis) and K3021002_pET11a (NSP4_K863030_pET11a_6xHis) respectively. These results indicated the successful assembly of the insert part (NSP4_Lac1326_6xHis and NSP4_K863030_6xHis) and the expression vector (pET-11a).
T7 short: TAATACGACTCACTATAGG
T7 term: CTAGTTATTGCTCAGCGGT
2. Constructs have correct sequences (check with sequencing and sequence alignment)
K3021004_pET11a (NSP4_Lac1326_pET11a):
To futher confirm that our constructs have correct sequence, we send our clones (with positive PCR results) out to sequencing.
The sequencing results show that we have successfully assembled target genes K3021004 (NSP4_Lac1326_6xHis; Figure 2) and K3021002 (NSP4_K863030_6xHis; Figure 3) to the vector (pET-11a).
3. Successful expression of laccase protein
To validate the protein expression of K3021004 (with Lac1326 laccase), K863000 and K3021002 (with K863030 laccase), we performed SDS-PAGE (coomassie blue staining) and Western blot analysis. To make Lac1326, K863000 and K3021002(with K863030 laccase) easily detectable via Western Blot, we designed our constructs to include a “His tag” which is targeted by a commercially available antibody. With the SDS-PAGE and western blot (anti-his for his-tagged protein), we found successful expression of K3021004 (with Lac1326 laccase), K863000 and K3021002 (with K863030 laccase).
Before performing the SDS-PAGE, we grew up our engineered E. coli cells containing a plasmid with K3021004 (with Lac1326 laccase), K863000 and K3021002 (K863030) under control of the T7 promoter. Cells were induced with 0.4mM, 1.0mM or 1.2mM IPTG until either OD0.4 or OD1.2 (wavelength: 600nm) at 25°C or 30°C. After expression, cells were then lysed according to our protein extraction protocol, and supernatant and pellet were collected for the SDS-PAGE.
For more experimental details of the Western Blot and SDS-PAGE, please see protocol.
(a)
- Lane1: pET-11a empty vector;
- Lane2: pET-11a empty vector+IPTG induction
- Lane3: K3021004 (Lac1326) colony1;
- Lane4:K3021004 (Lac1326) colony1+IPTG induction
- Lane5: K3021004 (Lac1326) colony2;
- Lane6:K3021004 (Lac1326) colony2+IPTG induction
- Lane7: K3021004 (Lac1326) colony3;
- Lane8:K3021004 (Lac1326) colony3+IPTG induction
- Lane9: K3021002 (K863030) colony1;
- Lane10: K3021002 (K863030) colony1+IPTG induction
- Lane1: K863000 colony2;
- Lane2: K863000 colony2+IPTG induction
- Lane3: K863000 colony3;
- Lane4: K863000 colony3+IPTG induction
- Lane5: K3021002 (K863030) colony1;
- Lane6: K3021002 (K863030) colony1+IPTG induction
- Lane7: K3021002 (K863030) colony2;
- Lane8: K3021002 (K863030) colony2+IPTG induction
- Lane9: K3021002 (K863030) colony3;
- Lane10: K3021002 (K863030) colony3+IPTG induction
As shown in Figure 4, Western Blot was performed to validate the presence of the his-tagged K3021004 (with Lac1326 laccase), K863000 and K3021002 (with K863030 laccase) protein. Anti-RNA polymersase beta was used as a loading control. At 58 kD, we found a band in lane 3 to lane 8 which corresponds to the approximate expected size of K3021004 (with Lac1326 laccase). We also found a band at 64kD in lanes 9 and 10, which is the expected size of K3021002 (with K863030 laccase).
As we used IPTG inducible promoter (T7) in our study, we further analyze the results of Western Blot to compare the laccase expression with/without IPTG. As shown in Figure 5, the expressions of different laccases under a variable of IPTG were compared. K3021004 (Lac1326), K3021002 (K863030) and K863000 with 1mM IPTG have exhibited higher expression levels (33.97, 41.66 and 28.75 folds, respectively) than K3021004 (Lac1326), K3021002 (K863030) and K863000 without IPTG (5.53, 21.99 and 15.53 folds). There was an enhanced expression of the laccases with IPTG as expected.
- Lane1: K3021004 (Lac1326): OD=0.4, IPTG=0.4mM, 30°C
- Lane2: K3021004 (Lac1326): OD=0.4, IPTG=0.4mM, 25 °C
- Lane3:K3021004 (Lac1326): OD=0.4, IPTG=1mM, 30 °C
- Lane4:K3021004 (Lac1326): OD=1.2, IPTG=1mM, 30 °C
- Lane5:K863000: OD=0.4, IPTG=0.4mM, 30 °C
- Lane6:K863000: OD=0.4, IPTG=0.4mM, 25 °C
- Lane7:K863000: OD=0.4, IPTG=1mM, 30 °C
- Lane8:K863000: OD=1.2, IPTG=1mM, 30 °C
- Lane9:K3021002 (K863030): OD=0.4, IPTG=0.4mM, 30 °C
- Lane10:K3021002 (K863030): OD=0.4, IPTG=0.4mM, 25 °C
- Lane11:K3021002 (K863030): OD=0.4, IPTG=1mM, 30 °C
- Lane12:K3021002 (K863030): OD=1.2, IPTG=1mM, 30 °C
- Lane13: pET-11a empty vector without IPTG
After confirming the expression of laccases and confirming the laccases under T7 promoter can be regulated by IPTG, we further tested how laccases vary across different conditions (cell growth phase, temperatures, IPTG concentration), as shown in Figure 6.
The figure compares the expression of K3021004 (Lac1326), K863000 and K3021002 (K863030) under different conditions including temperature, E coli and IPTG concentration. K3021004 (Lac1326) expressed under OD=0.4, IPTG=0.4mM at 25°C, K863000 expressed under OD=0.4, IPTG=0.4mM at 30°C and K3021002 (K863030) expressed under OD=0.4, IPTG=0.4mM at 30°C had displayed the highest fold changes of 24.58, 51.33 and 44.16 respectively, compared with the pET-11a empty vector, signifying that OD=0.4, IPTG=0.4mM are comparably the best expression condition for all of the laccases while 25°C is the best expression temperature for K3021004 (Lac1326) and 30°C for K863000 and K3021002 (K863030).
4. K863000 and K863010 induction results
Consistent with characterization by previous iGEM teams, we found no expression of laccase with K863010 plasmid (contains a fungal laccase, expected to be IPTG regulated), as shown in Figure 8.
To the best of our knowledge, there is no functional IPTG-regulated fungal laccase in the iGEM part registry. We here successfully add one (K3021002), as an improvement of the part K863010, which cannot be expressed.
5. Secretion signal peptides are functional in laccases
- Lane1: K3021004 (Lac1326): OD=0.4, IPTG=0.4mM, 30°C
- Lane2: K3021004 (Lac1326): OD=0.4, IPTG=0.4mM, 25°C
- Lane3:K3021004 (Lac1326): OD=0.4, IPTG=1mM, 30°C
- Lane4:K3021004 (Lac1326): OD=1.2, IPTG=1mM, 30°C
- Lane5:K3021002 (K863030): OD=0.4, IPTG=0.4mM, 30°C
- Lane6:K3021002 (K863030): OD=0.4, IPTG=0.4mM, 25°C
- Lane7:K3021002 (K863030): OD=0.4, IPTG=1mM, 30°C
- Lane8:K3021002 (K863030): OD=1.2, IPTG=1mM, 30°C
- Lane9: pET-11a empty vector without IPTG
Since we designed a secret form for the two laccases, we hypothesized that there would be his-tagged protein in the medium in which two genetically engineered E. coli were cultured.
First of all, we obtained the cell-free medium by spinning down the cells. We then used the Nickel-pulldown Assay and Western Blot to confirm the expression of his-tagged laccase. The results (Figure 9 and Figure 10) showed that the fold changes of K3021004 (with Lac1326 laccase) and K3021002 (with K863030 laccase) was 389.5 and 62.12 (compared to pET-11a control), indicating expression of K3021004 (with Lac1326 laccase) (significant) and K3021002 (with K863030 laccase) in the medium .
For detailed Nickel-pulldown protocol, please refer to our protocol page.
6. Laccases expressed can decolorize dye
In order to investigate the biodegradable reactivity of the laccases, dye (Indigo Carmine) decolorization experiments were conducted (Figure 11).
As shown in Figure 12, the laccase K863000 from Bielefied-Germany 2012 was the most efficient enzyme with 81.09% removal of Indigo Carmine (initial concentration: 10 mg/L) after 96 hours incubation with ABTS at 37°C comparing to K3021004 (Lac1326) and K3021002 (K863030) which decolorized 47.62% and 22.01% of Indigo Carmine after 96 hours.
7. Successful EDC degradation by laccases
In order to validate our concept of using laccases to degrade Endocrine Disrupting Chemicals, biodegradation test were conducted. We used beta-estradiol (one of the EDCs) as our the target substrate. After incubation of laccases with beta-estradiol, we analyzed the amount beta-estradiol with Liquid Chromatography-Mass Spectrometry.
As shown in Figure 13 and Figure 14, the concentration of beta-estradiol decreased after treatment with K3021004 (with Lac1326 laccase), K863000 and K3021002 (with K863030 laccase) proteins, compared with pET-11a (empty vector), which successfully demonstrated our concept of utilizing K3021004 (with Lac1326 laccase) for EDC degradation. Among all of the laccases, K863000 and K3021004 (with Lac1326 laccase) had respectively displayed the lowest and second lowest intensity of 2137.657 and 2421.598, signifying K863000 possesses the highest biodegradation activity of all.
Moreover, we found that the results of dye decolorization and EDC degradation are consistent. Protein K863000 has the highest laccase activity, followed by K3021004 (with Lac1326 laccase) (OD0.4, IPTG=0.4mM, 25°C;) and then K3021002 (with K863030 laccase).
For detailed EDC degradation protocol, please refer to our protocol page.
Conclusion
Overall, we confirmed that laccases with signal peptides (K3021002 and K3021004) can be successfully expressed in E. coli. We also confirmed that laccases with signal peptides are functional in decolorization and EDC degradation. Moreover, we proved that our signal peptides can export his-tagged laccase to the medium, which may help to degrade EDCs outside the cell. We believe that our project significantly contributes to utilizing laccase in EDC degradation. We hope that with these kinds of engineered laccases, we could help to eliminate EDC pollution in the future.
Laccase secretion from recombinant Cyanobacteria
EDCs pollution is not solely an issue in wastewater. EDCs are bioaccumulation compounds, which would affect the ecology system and our drinking water source. Since the effect of EDCs to nature may not become evident until later, such pollution has remained as unsolved. To address this issue, we propose an engineered cyanobacteria strain to secret Laccase, which would harvest sunlight as an extra energy source and provide a possible solution to achieve nature bioremediation.
Overview
This study describes the construction and characterization of several new BioBricks, which will allow the future investigation of Laccases secretion by the pila pathway. However, due to the limited time, this sub-project was yet to finish.
Background
Cyanobacteria are prokaryotic autotrophic organisms, which would be found in a different water source, ranging from pristine hot springs to eutrophic aquatic water bodies. They are frequently found in polluted sites and wastewater since cyanobacteria have high N, P requirements. Through the massive intake of such high loads of these nutrients from sewage, the water quality would be improved. In additional, cyanobacteria would also remove and tolerant pollutants like heavy metals and inorganic and organic contaminants, which allow them to adapt to the harsh environment.
Aims
In this sub-project, we aim to develop an engineered cyanobacteria strain to produce and secretion laccases, which sunlight would be harvest as an extra energy to 1) further boost the productivity, or 2) to adapt the harsh environment in nature.
Results
PCR and Gel Electrophoresis
(a)BBa_K3021006 (pilA_Lac1326_pSCBe):
- Lane 1: 1Kb Plus Ladder;
- Lane 2: pilA_Lac1326_0;
- Lane 3: pilA_Lac1326;
- Lane 4: L_pSCBe_0;
- Lane 5: L_pSCBe
(b)BBa_K3021007 (pilA_Lac1326_mCherry_pSCBe):
- Lane 1: 1Kb Plus Ladder;
- Lane 2: pilA_Lac1326_pSCBe_mC_0;
- Lane 3: L_mCherry_0;
- Lane 4: pilA_lac1326_pSCBe_mC;
- Lane 5: L_mCherry.
The figure shows the PCR results. The band sizes in the figure are consistent with our expectations, which preliminarily indicates our success in PCR.
(a) BBa_K3021006 (pilA_Lac1326_pSCBe), (b) BBa_K3021005 (pilA_K863030_pSCBe), (c) BBa_K3021007 (pilA_Lac1326_mCherry_pSCBe).
This figure shows that there are single colonies on the antibiotic plates, which indicates that both of them had an antibiotic resistance.
Check clone
- Lane 1: Invitrogen 1Kb plus DNA Ladder.
- Lane 2: negative control.
- Lanes 3-10: PCR products with pSCBe_seqF and pSCBe_seqR2 primers using K3021005_pSCBe(pilA_k863030_pSCBe_1) from different plasmids as templates.
- Lanes 11-12: Empty.
Figure 15 shows the agarose Gel electrophoresis of PCR with pSCBe_seqF and pSCBe_seqR2 primers. We first extracted DNA from the antibiotic-resistant clones and then validated them with PCR. The product of PCR from lane 3 to 10 shows a band at 1850 bp which matches the length of K3021002_pSCBe (pilA_K863030_pSCBe) PCR product, indicating the successful assembly of the insert part (pilA_K863030_6xHis) and the expression vector (pSCBe).
pSCBe-seqF: GGCTCGTATAATGTGTGGAA
pSCBe_seqR2: TAGTAGAGAGCGTTCACCGAC
Alignment
To future confirm that our constructs have correct sequence, we send our clones out to sequencing.
The sequencing results show that we have successfully assembled target genes BBa_K3021006 (pilA_Lac1326_6xHis; Figure 18) , BBa_K3021005 (pilA_K863030_6xHis; Figure 19) and BBa_K3021007 (pilA_Lac1326_mCherry_6xHis; Figure 20) to the vector (pSCBe).
Transformation of Cyanobacteria (Synechococcus sp.)
After confirming the sequences of our constructs, we intended to transform the plasmids into cyanobacteria. We saught help from Dr. Song for the method of transformation and try our best, but because of the time limit, we didn’t achieve our goal.