Experiments
Introns
Before continuing with other experiments, we first needed to ensure that the artificial introns containing the binding sites for the dCas9 complexes worked. In other words, we needed to make sure they were recognised by the yeast cells as being introns and spliced out of the mRNA transcript to give the correct sequence for the receptor.
We first constructed a basic sequence for our artificial introns. The skeleton sequence was taken from Gatermann et al (1989):
5’ – GTAGGT(19N)CTAAT(4N)AG – 3’
Since the introns needed to contain sgRNA binding sites, these were inserted into the 19N section and the 4N section was removed. The sgRNA sequences including the PAM sites inserted into a pair of introns were:
5' TCTAACCCCCACCTCCTGTTCGG 3' and 5' GGCAAGCGCCATGTCTAGTGAGG 3'
To prove the introns worked, we designed a proof of concept experiment using the Gal4 transcription factor protein. A pair of artificial introns were inserted into the gene encoding the Gal4 with Gibson assembly. The Gal4 protein was ordered as 4 gBlocks, 1 of which was ordered as 2 different versions, one with and one without the intron pair. This was to allow us to assemble a wild type Gal4 as a control, as well as the one containing the intron pair. The strain of yeast that we used, MaV203, is a Gal4 knockout, so it does not contain its own copy of the gene. The Ura3 gene, which encodes an enzyme involved in pyrimidine ribonucleotide synthesis, is under the control of a Gal4 promotor and can therefore only become active when a functioning Gal4 is present. This strain of yeast, when un-transformed, can only grow if there is uracil added to the media. The vector we used to insert the Gal4 was the pESC-LEU plasmid, and therefore after transforming the yeast we were able to select for the plasmid by growing the cells on SD agar plate deficient in Leucine. Once we knew the transformation was successful, we inoculated liquid SD -Ura cultures with single yeast colonies. These cultures were deficient in uracil, and therefore the cells should only have been able to grow if there was a functioning Gal4. Yeast growth in this media therefore indicated that the Gal4 we had inserted was functioning, implying that the introns were being properly spliced out of the transcript.
Results
The yeast containing wild type and intron Gal4 were grown in 3 types of liquid media, YPD (non-selective), SD -Leu (selective for the plasmid) and SD -Ura (selective for the Gal4), as well as on YPD and SD -Ura plates. After 4 days, the YPD plates and liquid cultures showed a lot of growth, as expected, as did the SD -Leu cultures. The SD -Ura cultures started to show visible cloudiness after 4 days, and colonies appeared on the plates after 5.
The OD600 readings for the liquid were taken after 5 days and are shown in the Table below.
| Sample |
SD-Leu |
SD-Ura |
YPD (Control) |
| Gal4 INT rep1 |
1.913 |
0.364 |
2.665 |
| Gal4 INT rep2 |
1.889 |
0.299 |
2.349 |
| Gal4 INT rep3 |
1.849 |
0.196 |
2.309 |
| Gal4 WT |
1.814 |
0.139 |
2.155 |
| Wild Type (no Gal4) |
0.1 |
- |
2.240 |
Mutations
The aim of this experiment is to characterize the type and amount of mutations generated by the three different synthetic mutagenic enzymes across different time-frames and against varying lengths of target sequence, to determine the best enzyme and the best overall mutagenic conditions.
Three mutagenic enzymes are being tested, as described in the Components section: dCas9-FokI, dCas9-AID and dCas9-eAID (hereafter FokI, AID and eAID respectively). Their genes and the gRNA expression cassettes are assembled within the pESC-LEU plasmid vector as described in the Lab Notebook Section. The genes are placed under the control of the inducible GAL1,10 promoters, whose expression is regulated by the presence of galactose.
The target gene is a synthetic version of GAL4, containing synthetic introns within its sequence which in turn contain the gRNA complementary sequence that allows for FokI, AID and eAID to precisely target their mutating activity. A total of four pESC-LEU plasmids are prepared with four different versions of the GAL4 gene -as described in the Lab Notebook Section- each of which contains either 2, 4, 6, or 8 synthetic introns inserted at varying locations throughout the gene.
S. cerevisiae (MaV203 strain) cells are transformed with a combination of 2 plasmids, containing either one of the three enzymes and either one of the four target genes, so that each enzyme is tested against all four versions of GAL4:
- FokI + GAL4-8int
- FokI + GAL4-8int
- FokI + GAL4-4int
- FokI + GAL4-2int
- AID + GAL4-8int
- AID + GAL4-6int
- AID + GAL4-4int
- AID + GAL4-2int
- eAID + GAL4-8int
- eAID + GAL4-6int
- eAID + GAL4-4int
- eAID + GAL4-2int
The transformed cells are plated on SD-LEU plates for selection of correctly transformed colonies and on YPD plates as controls.
The selected colonies are then transferred to LEU deficient liquid medium supplemented with 2% raffinose instead of glucose. Right before the cells reach the log growth phase (OD600 = 0.3), galactose is added to the medium to induce the expression of the mutagenic enzyme. Different amounts of galactose are used to test the activity of the enzymes across different time intervals. The rationale behind this is that, since the expression of mutating enzymes is dependent on the presence of galactose in the media, higher amounts of the latter will be consumed to completion later than lower amounts, thus allowing mutations to occur for a longer time. Galactose concentrations are 0.1%, 0.2%, 0.5%, 1%, 1.5%, 2%, 3%, 4%. Cells are harvested during late log phase (OD600 = 0.9-2) and plasmid DNA is extracted.
The extracted DNA from all conditions (96 in total) is sent for sequencing with primers flanking the synthetic GAL4 gene. Each condition will contain multiple reads that differ from each other depending on how they were mutated. By aligning those reads the distribution of the mutations along the targeted gene can be mapped.
Receptor
The aim of this experiment is to build a calibration curve for bioluminescent signal generated by the dimerization of the synthetic vascular endothelial growth factor receptor 1 (VEGFR1) coupled to the NanoLuc® system occurring when the ligand (Human hVEGF-A) is correctly recognized by the receptor.
The VEGFR1 gene is a homodimer protein which dimerizes only on correct binding of the ligand. To monitor its activation, each of the two components of the NanoLuc® system (SmBit and LgBit) had to be coupled to either one of the receptor monomers. Therefore, it is necessary to code the two receptor dimers into two separate genes: the same sequence is used for the extracellular and transmembrane domains, while the intracellular domain either has the SmBit (VEGFR1-S gene) or the LgBit (VEGFR1-L). Both genes are placed under the control of TEF1 constitutive promoter and assembled into the two multiple cloning sites of the plasmid vector pESC-LEU.
The plasmid is transformed into Saccharomyces Cerevisiae cells, the cells are grown at 30°C to mid log phase (OD600 = 0.6) and then transferred to a 12-well plate. Each well is supplemented with a different concentration of hVEGF-A purified recombinant protein (0.01nM, 0.02nM, 0.05nM, 0.1nM, 0.2nM, 0.5nM, 0.8nM, 1.0nM, 1.2nM, 1.5nM, 1.8nM, 2.0nM).
Cells are incubated at 30°C inside the Synergy™ HTX Multi-Mode Microplate Reader, which is programmed to measure bioluminescence every 15 minutes for 6 hours.
Once the calibration curve is built for the intensity of the bioluminescence signal caused by receptor dimerization, it can be used to determine the binding affinity of the mutated receptor to any other ligand: simply compare the bioluminescence levels generated by the target ligand binding to the mutated receptor with the calibration curve and determine the amount of ligand bound.
Protocols
If it appears that you don't have a PDF plugin for this browser.
No worries.. you can
click here
References
1. Gatermann, K. B., Hoffmann, A., Rosenberg, G. H., & Käufer, N. F. (1989). Introduction of functional
artificial introns into the naturally intronless ura4 gene of Schizosaccharomyces pombe. Molecular and cellular biology, 9(4), 1526-1535.
