Team:GIFU TOKAI/Improve
Part Improvement
T7 promoter for in vitro transcription
BBa_K222001
Description
T7 promoters can produce rich amount of RNA from DNA using T7 RNA Polymerase. T7 promoters have unique sequence which can be only recognized by T7 RNAP. The promoter is typically used for production of protein in E.coli, especially in BL21 (DE3).
This year, iGEM GIFU TOKAI team tried to generate linear mRNA in vitro and used in vitro transcription kit. As minimal sequence for T7 promoter, we need TAATACGACTCACTATAGGG. In iGEM registry of T7 promoter collection, only TAATACGACTCACTATAGG and TAATACGACTCACTATAG were found. Thus, we decided to compare efficiency of transcription of RNA of each promoter. BBa_K3222000 is an improved part of BBa_K1614000. BBa_K1614000 codes T7 promoter for expression of functional RNA. We added two extra G to maintain transcription in vitro constantly.
Figure.1 Sequence of T7 promoter
Methods
We prepared three kinds of DNA templates which have each different T7 promoter. These T7 promoters are TAATACGACTCACTATAGGG, TAATACGACTCACTATAGG and TAATACGACTCACTATAG. These DNA templates contain T7 promoter, SD sequence and sfGFP. DNA templates were amplified by performing PCR and transcribed by MEGAscript. The product was assayed by Agilent Bioanalyzer 2100, and we compared the amount of each mRNA which is transcripted.
Figure.2 Comparison of each sequence used in this study
T7 Polymerase
This enzyme derives from T7 phage. It requires double-stranded DNA that contains the T7 promoter sequence as a template and NTPs as substrates and synthesizes the single-strand RNA was complementary to the template downstream of the promoter. It has very high specificity for T7 promoter, with almost no recognition of other promoters, so it allows transcribe the destination DNA accurately efficiently. However, unfortunately, the polymerase has a critical defect that enzyme adds extra nucleotides at the terminus of the RNA that property is called the N+1 activity. To prevent this, methoxylated second nucleotide from 3’ ends for down strand in the template DNA. Methoxylation increases the density near the methoxylated base gets crowded, so the density is increased. Therefore, high-density nucleotide makes extract nucleotide away.
Results
In PURE system, BBa_I746916 was successfully expressed and, the expressed sfGFP was turned into green under the UV. The figure.1 shows the sfGFP under UV exposure.
Figure.1 sfGFP under UV exposure (left: BBa_I746916, right:Negative control)
Short Summary
The target protein is detected by Western blotting. As a result, the fluorescence reaction was shown sufficiently. sfGFP can be used as a quick Positive Control.