Team:GIFU TOKAI
iVEPOP
in vitro eternal production of protein
Research article | Revised 13 December 2019
Contiuous translation coupling reaction of circular RNA in cell-free system can perform mass-production of protein
*1 Faculty of Applied Biological Sciences, Gifu University, Japan
Email: igem.gifu@gmail.com
Description
We, iGEM GIFU_TOKAI, focus on mRNA and changing its topological form into circular to create a new method for mass-production of protein in cell-free system this year. In the current research of circular RNA (circRNA) for protein production, expressing tandem-repeated protein was generated by circRNA without a stop codon. It shows circRNA has a potential ability that it can skip the rate-limiting process of the central dogma of molecular biology, binding ribosomes to mRNA. However, with conventional circRNA, functional protein cannot be translated because protein aggregation quickly occurs. Therefore, we decided to use translation-coupling system, which is found in operons of bacteria to produce monomer protein from circRNA. By applying it to circRNA, ribosomes repeat translation-coupling phenomenon in circRNA and are expected to express monomer protein. Our final goal is to produce functional proteins such as antibodies more efficiently and cheaper in cell-free system to provide medicaments consistently.
Introduction
Messenger RNA is a type of molecule that conveys information of alignment of amino acids to the ribosome, and the translated peptides fold as protein. The fragments of mRNA are generated by RNA polymerase following the genomic DNA alignment. This process is called transcription and a vital part of the central dogma of molecular biology. The shape of mRNA keeps linear form after transcription. Technically, the single-stranded molecule has 5' end and 3' end. In circular RNA (circRNA), the ends can be removed since a phosphodiester bond covalently links 5'and 3' ends of circRNA. CricRNA also belongs to a group of single-stranded RNA, and various kinds of them are generated in nature.
Using cricRNA, Perriman and Ares made it possible to express tandem-repeated GFP in E.coli. In their study, the circular object with only RBS, an initial codon, and CDS of GFP, but not with a stop codon was generated by permuted intron-exon splicing strategy. A long chain of multimeric green fluorescent protein (poly-GFP) was produced in E.coli. Later, this reaction was named as Rolling Cycle Amplification (RCA). The big difference between RCA and standard translation step is that ribosomes are not released and keep translation while they grind in a circular motion on circRNA. From this point, RCA can skip the rate-limiting step of the central dogma of molecular biology and speed up the translation process. This hypothesis was demonstrated in prokaryotic cell and eukaryotic by the team of Abe. Thus this method is expected to be applied to industries for mass-production of protein.
However, one problem we may confront is that the expressed protein from circular RNA is easily aggregated because of its too large-size scale. The product size is typically more than 250 kDa when translation occurs following RCA. This phenomenon may be due to protein molecules pulling against each other by van der Waals force. Expressing functional protein is an indispensable goal to make RCA feasible to use industrial level. Therefore, iGEM GIFU TOKAI aims to produce monomer GFP from circRNA keeping the potential translation power of RCA. The main principle of our project is a translation-coupling system which is found in operons of bacteria. Bacterial operon typically generates one long-chain RNA fragment at the stage of transcription, and multiple proteins are translated from it. This phenomenon is called translation coupling. Imitating the sequence of the operon on circRNA, translation coupling can occur. The ribosomes repeat the translation process on circRNA.
In this research, we show for the first time that circular RNA synthesized in vitro can produce a more significant amount of sfGFP than linear RNA in a prokaryotic translation system. Moreover, we demonstrate that functional protein can be expressed as a functional protein.
Figure.1 Translation coupling inside circRNA
Results
Amplification of DNA fragment for transcription
Template DNA was amplied by PCR using primers' set below. Second base (T) of the reverse primer was changed into 2-o-methyl RNA to prevent ramdom additon of the base at the end of 3' this time. The result of PCR amplification was confirmed by 1.5% agarose gel electrophoresis. This product was purified and used as the template DNA for in vitro transcription.
| Primer name | Sequence |
|---|---|
| T7_full | cgcggatcctaatacgactcactatag |
| Rev_2-O-methyled | a mt ttgtacagttcatccat |
>Sequence of the product cgcggatcctaatacgactcactatagggAAGGAGATATACCAatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaata
Transcription of linear RNA in MEGAscript with an excess amount of GMP
Circularization step requires mRNA primed from Guanosine monophosphate to join the ends by T4 RNA ligase. Thus, we added an excess amount of GMP to MAGEscript. In the previous report from Abe, the group added 7.5 mM GMP to 1.5 mM GTP. At this time, we tried 7.5 mM, 15 mM and 30 mM of GMP to see whether suppression of transcription occurred by incorporating GMP in the middle of the transcription step. As a result, mRNA was transcripted well in the all condition. Considering this result, all the mRNA used in this research was generated under the condition of 30 mM GMP. The assay was performed by Agilent Bioanalyzer 2100.
Figure.3 Transcription of RNA with a surplus amount of GMP
Synthesis of circular RNA using T4 RNA ligase 2
Circularization was performed following the protocol of Abe. However, under the condition of 1 μM RNA, no circular RNA and dimers were confirmed. So, we circularized 0.1 μM ,0.2 μM and 0.5 μM of RNA. The result was confirmed by 3% agarose gel electrophoresis and 10% denaturing PAGE. Using agarose electrophoresis, circRNA and linear RNA may not be possible to be separated. Denaturing PAGE was conducted to perform separation of each band. After electrophoresis, each gel was stained by Ethidium Bromide. However, only dimers of the RNA were confirmed in our experiments. RNase R is 3'→5' exoribonuclease. It can only degrade linear RNA. Using this enzyme, almost all the linear RNA can be eliminated, and the only circRNA can remain. For the circularity check, we used this enzyme and observed whether the remained bands could be gained. As Figure.5 shows, we could not see the clear band of circular RNA.
Figure.4 3% Agarose Gel Electrophoresis (1, 2: linear RNA, 3: 0.5 μM RNA (Circularized), 4: 0.2 μM RNA (Circularized)
In figure4, 0.5 μM and 0.2 μM of RNA was circularized using T4 RNA Ligase2. Both of them shows two types of bands. From the length, the band above is the dimer of the RNA fragment and the band below is monomer RNA.
Figure.5 3% Agarose Gel Electrophoresis and circularity check with RNase R
In figure5, 0.5 μM and 0.2 μM of RNA was degraded by RNase R. After degradation, all of the bands were disappeared.
Figure.5 10% Denaturing PAGE and circularity check with RNase R
Western Blotting
To confirm whether we could gain sfGFP from circRNA, we performed Western Blotting analysis. We also performed fluorescence measurement, but no difference between negative control, circRNA and linear RNA were confirmed. Thus, we moved on to western blotting analysis to consider the small amount of sfGFP expression. As a result, we could see the band from positive control and linear RNA only. No sfGFP expression was confirmed in circular RNA.
Figure.7 Western Blotting
Circularity check by reverse transcription
Afetr performing reverse transcription, we performed PCR amplification to sequence the junction region. The result was shown in the figure below. The unique sequence which can be found only in circular RNA was sequenced. From this result, even a small amount of circular RNA was synthesized.
Figure.7 Sequence result of the product of reverse transcription of circRNA
Expression speed measurement by real-time PCR machine
To consider the speed of expression, we need to invent the method to measure change in time of Fluorescence Intensity. Thus, this year we tried to measure the amount of sfGFP by Real-time PCR machine. The wavelenght of fluorescence of FAM is quite similar with GFP and we believed it was possible to consider the amount of sfGFP by Real-time PCR machine. We measured FI of fluorescein at 8 different concentration. The result was shown in the figure above.
Figure.8 Calibration curb of fluorescein
We also measured expression speed by real-time PCR machine. Speed of 5nM and1nM did not change much. We found that the initial speed of expressing can be measured.
Figure.9 Time change in fluorescence intensity
Discussion
From the result of the sequence, we confirmed the synthesize of the circular RNA (circ RNA). However, the efficiency of the circularization was too low to make enough amount of circ RNA and we were not able to quantitate the amount of it. One reason for the low efficiency of the circularization is its size. The RNA we used was about twice the size of the RNA which was used in the previous study. So the RNA we used was too large. In addition, we were not able to synthesize proteins from the circ RNA. The problem with the sequence of the RNA is thought to be the cause since we were not able to synthesize even a small amount of protein from the result of the sequence of the linear RNA. In order to put circular RNA into practical use, it is necessary to review the RNA sequence and increase the efficiency of the circularization.
Methods
- Preparation of linear mRNA
KAPAHiFi DNA Polymerase (NIPPON Genetics Co., Ltd) amplified the DNA sequence following the instruction of the manufacturer. As the reverse primer, the second base from 5' end was 2-o-methylated. Linear RNA strands were prepared from the PCR products by in vitro transcription. Linear RNAs were prepared using the MEGAscript High Yield Transcription Kit (Invitrogen by Thermo Fisher Scientific, Waltham, MA, USA). An excess amount of GMP was added (7.5 mM, 15 mM, 30 mM to 1.5 mM GTP) to make the in vitro transcripts mono-phosphorylated. After incubation, the reaction was treated with DNase to remove the DNA template. The linear RNA was purified by MEGAclear (Invitrogen by Thermo Fisher Scientific, Waltham, MA, USA).
- Circularization of mRNA
Transcribed linear RNA was circularized using T4 RNA ligase 2 (New England Biolabs) on a guide DNA. After mixing the RNA solution with the guide DNA and the buffer, the mixture was incubated at 98 °C for 5 mins and cooled at room temperature. linear RNA (0.2 μM, 0.5 μM, 1 μM) was heated with T4 RNA ligase 2 in a mixture of 50 mM Tris-HCl (pH 7.5), 2 mM MgCl2, 1 mM DTT and 0.4 mM ATP at 37 °C for 3 h.
- Circularity check by exonuclease
RNase R (1 unit/uL: abm Inc., Vancouver, Canada) degraded the linear RNA in the buffer provided by the company for 10 mins at 37 °C. The reaction mixture (5 μL) was analyzed by 10% denaturing PAGE.
- Expression of sfGFP in PURE system
Circular RNA was mixed with PUREfrex (GeneFrontier, Chiba, Japan) and incubated for 4 h at 37°C in a volume of 20 μL following the instruction. Briefly, the proteins were separated by 5–20%SDS-PAGE and transferred to nitrocellulose membranes. For CBB staining, the GelCode Blue Safe Protein Stain (Thermo Fisher) was used. For western blotting, 5% nonfat dry milk in TBS containing 0.1% Tween-20 was used for blocking and antibody dilution. For lectin blotting, TBS containing 0.1% Tween-20 was used for the blocking and dilution of biotinylated lectin or HRP-Streptavidin (VECTASTAIN ABC Standard Kit). For streptavidin blotting, after blocking with TBS containing 0.1% Tween 20, the membranes were incubated with HRP-Streptavidin (VECTASTAIN ABC Standard Kit). Proteins were detected with Western lightning ECL Pro (PerkinElmer) using an ImageQuant LAS-4000mini (GE Healthcare).
- Expression speed measurement by real-time PCR machine
Fluorescein solution was diluted 100-fold, and we dispensed it to PCR tubes diluting from 10-2 to 10-9-fold as the control. We prepared these three sets. Second, GFP template DNA solution was diluted 1, 5, and 10-fold, and we prepared these three sets respectively with myTXTL mixture. We also prepared negative controls three sets. Finally, we carried out qPCR with all samples we prepared and assayed the quantity of GFP which DNA expressed.
- The detailed method of our protocol
All of the methods with the precise amount, primer sets and incubation time are shown in the PDF file below.
Acknowledgement
We would like to thank our PI; Professor H. IWAHAI, Professor T. YABE for general support. and other professors; Professor T. YOKOGAWA , Professor T. NAKAGAWA(Gifu University), Takashi KANAMORI, PhD, Rena MATSUMOTO, PhD (Gene Frontier), Professor H. ABE (Nagoya University), Professor Y. KIZUKA (G-CHAIN, Gifu University) for Technical support. We are grateful to President MORIWAKI & Gifu University, Cosmo Bio, Kagami reunion, Snapgene, Arbor Biosciences, Twist biosciences for various supports..
References
1. Gundula R et al.(1994).The mechanism of translational coupling in Escherichia coli. The Journal of Biological Chemistry, 27,18118-18127
2. Laszlo J et al.(1994). Ribosome recycling factor (ribosome releasing factor) is essential for bacterial growth. Biochemistry, 91, 4249-4253
3. Naoko A et al.(2015). Rolling Circle Translation of Circular RNA in Living Human Cells. Sci. Rep. 5, 16435; doi: 10.1038/srep16435
4.Inokuchi, Y. et al. Role of ribosome recycling factor (RRF) in translational coupling. The EMBO Journal. 19,3788-3798(2000)
5.Shimizu, Y. et al. Cell-free translational reconstituted with purified components. Nature biotechnology. 19, 751-755(2001)
6.Kao, C, Zheng, M. A simple efficient method to reduce nontemplated nucleotide addition at the 3’ terminus of RNAs transcribed by T7 RNA polymerase. RNA,5 1268-1272(1999)
We, iGEM GIFU_TOKAI, focus on mRNA and changing its topological form into circular to create a new method for mass-production of protein in cell-free system this year. In the current research of circular RNA (circRNA) for protein production, expressing tandem-repeated protein was generated by circRNA without a stop codon. It shows circRNA has a potential ability that it can skip the rate-limiting process of the central dogma of molecular biology, binding ribosomes to mRNA. However, with conventional circRNA, functional protein cannot be translated because protein aggregation quickly occurs. Therefore, we decided to use translation-coupling system, which is found in operons of bacteria to produce monomer protein from circRNA. With applying it to circRNA, ribosomes repeat translation-coupling phenomenon in circRNA and are expected to express monomer protein. Our final goal is to produce functional proteins such as antibodies more efficiently and cheaper in cell-free system to provide medicaments consistently.
Messenger RNA is a type of molecule that conveys information of alignment of amino acids to the ribosome, and the translated peptides fold as protein. The fragments of mRNA are generated by RNA polymerase following the genomic DNA alignment. This process is called transcription and a vital part of the central dogma of molecular biology. The shape of mRNA keeps linear form after transcription. Technically, the single-stranded molecule has 5' end and 3' end. In circular RNA (circRNA), the ends can be removed since a phosphodiester bond covalently links 5'and 3' ends of circRNA. CricRNA also belongs to a group of single-stranded RNA, and various kinds of them are generated in nature.
Using cricRNA, Perriman and Ares made it possible to express tandem-repeated GFP in E.coli. In their study, the circular object with only RBS, an initial codon, and CDS of GFP, but not with a stop codon was generated by permuted intron-exon splicing strategy. A long chain of multimeric green fluorescent protein (poly-GFP) was produced in E.coli. Later, this reaction was named as Rolling Cycle Amplification (RCA). The big difference between RCA and standard translation step is that ribosomes are not released and keep translation while they grind in a circular motion on circRNA. From this point, RCA can skip the rate-limiting step of the central dogma of molecular biology and speed up the translation process. This hypothesis was demonstrated in prokaryotic cell and eukaryotic by the team of Abe. Thus this method is expected to be applied to industries for mass-production of protein.
However, one problem we may confront is that the expressed protein from circular RNA is easily aggregated because of its too large-size scale. The product size is typically more than 250 kDa when translation occurs following RCA. This phenomenon may be due to protein molecules pulling against each other by van der Waals force. Expressing functional protein is an indispensable goal to make RCA feasible to use industrial level. Therefore, iGEM GIFU TOKAI aims to produce monomer GFP from circRNA keeping the potential translation power of RCA. The main principle of our project is a translation-coupling system which is found in operons of bacteria. Bacterial operon typically generates one long-chain RNA fragment at the stage of transcription, and multiple proteins are translated from it. This phenomenon is called translation coupling. Imitating the sequence of the operon on circRNA, translation coupling can occur. The ribosomes repeat the translation process on circRNA.
In this research, we show for the first time that circular RNA synthesized in vitro can produce a more significant amount of sfGFP than linear RNA in a prokaryotic translation system. Moreover, we demonstrate that functional protein can be expressed as a functional protein.
Various protein drugs, including antibodies for each disease, were found, and they are used for remedy in recent years. In very near future, we will need the antibody-drug more and more, but we cannot store almost all of them because it is unstable. Also, it is challenging to synthesize a large amount of them. Therefore, we decided to construct a system to mass-production of monomer protein as our first trial. To make it, we focused on cell-free system and circular RNA. As one example of the cell-free system, there is PURE system. PURE system is a kind of cell-free system established in 2016. The most prominent feature of PURE system is reconstruction type. The system contains only necessary factors for expressing, such as ribosomes. So, we can synthesize more clear proteins and purify more easily. It means that pharmaceutical companies can cut the cost, low the price of protein drugs.
Furthermore, the reaction is more stable than the conventional method. It is like a chemical reaction rather than a biological reaction. We also focused on another type of cell-free system like myTXTL. One of the problems of PURE system is its low efficiency of translation compared with other cell-free systems. We decided to use both of them to know which type of the cell-free system is fit in our project.
We also have our eyes on circular RNA. Translation reaction is subdivided into several steps, including initiation, elongation, termination, and ribosome recycling, initiation represents the rate‐limiting step. The rate-limiting step of translation is the step where ribosomes adhere to RNA. In circular RNA, once the ribosome is bound, it does not leave, and the rate-limiting step can be skipped, so it generates much protein faster than linear RNA. In the research of Perriman and Ares in 1998, they succeeded in expressing tandem-repeated GFP from circular RNA and showed it can be a revolutionary solution for a problem of the lack of expression power in the cell-free system since circular RNA can generate a large amount of protein compared with linear RNA. We set our goal of research to synthesize functional monomer protein a lot.
Besides, with the growth of the field of next-generation sequencing, unknown circular RNA is now being found in vivo. Even this research utilizes the logic of synthetic biology to solve the problem of the real world; our research is the latest in RNA engineering. Circular RNA is more stable than linear RNA because it is not decomposed by exonuclease in cells. Further applications would follow this project.
Amplification of DNA fragment for transcription
Template DNA was amplied by PCR using primers' set below. Second base (T) of the reverse primer was changed into 2-o-methyl RNA to prevent ramdom additon of the base at the end of 3' this time. The result of PCR amplification was confirmed by 1.5% agarose gel electrophoresis. This product was purified and used as the template DNA for in vitro transcription.
| Primer name | Sequence |
|---|---|
| T7_full | cgcggatcctaatacgactcactatag |
| Rev_2-O-methyled | a mt ttgtacagttcatccat |
>Sequence of the product cgcggatcctaatacgactcactatagggAAGGAGATATACCAatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaata
Transcription of linear RNA in MEGAscript with an excess amount of GMP
Circularization step requires mRNA primed from Guanosine monophosphate to join the ends by T4 RNA ligase. Thus, we added an excess amount of GMP to MAGEscript. In the previous report from Abe, the group added 7.5 mM GMP to 1.5 mM GTP. At this time, we tried 7.5 mM, 15 mM and 30 mM of GMP to see whether suppression of transcription occurred by incorporating GMP in the middle of the transcription step. As a result, mRNA was transcripted well in the all condition. Considering this result, all the mRNA used in this research was generated under the condition of 30 mM GMP. The assay was performed by Agilent Bioanalyzer 2100.
Figure.3 Transcription of RNA with a surplus amount of GMP
Synthesis of circular RNA using T4 RNA ligase 2
Circularization was performed following the protocol of Abe. However, under the condition of 1 μM RNA, no circular RNA and dimers were confirmed. So, we circularized 0.1 μM ,0.2 μM and 0.5 μM of RNA. The result was confirmed by 3% agarose gel electrophoresis and 10% denaturing PAGE. Using agarose electrophoresis, circRNA and linear RNA may not be possible to be separated. Denaturing PAGE was conducted to perform separation of each band. After electrophoresis, each gel was stained by Ethidium Bromide. However, only dimers of the RNA were confirmed in our experiments. RNase R is 3'→5' exoribonuclease. It can only degrade linear RNA. Using this enzyme, almost all the linear RNA can be eliminated, and the only circRNA can remain. For the circularity check, we used this enzyme and observed whether the remained bands could be gained. As Figure.5 shows, we could not see the clear band of circular RNA.
Figure.4 3% Agarose Gel Electrophoresis (1, 2: linear RNA, 3: 0.5 μM RNA (Circularized), 4: 0.2 μM RNA (Circularized)
In figure4, 0.5 μM and 0.2 μM of RNA was circularized using T4 RNA Ligase2. Both of them shows two types of bands. From the length, the band above is the dimer of the RNA fragment and the band below is monomer RNA.
Figure.5 3% Agarose Gel Electrophoresis and circularity check with RNase R
In figure5, 0.5 μM and 0.2 μM of RNA was degraded by RNase R. After degradation, all of the bands were disappeared.
Figure.5 10% Denaturing PAGE and circularity check with RNase R
Western Blotting
To confirm whether we could gain sfGFP from circRNA, we performed Western Blotting analysis. We also performed fluorescence measurement, but no difference between negative control, circRNA and linear RNA were confirmed. Thus, we moved on to western blotting analysis to consider the small amount of sfGFP expression. As a result, we could see the band from positive control and linear RNA only. No sfGFP expression was confirmed in circular RNA.
Figure.7 Western Blotting
Circularity check by reverse transcription
Afetr performing reverse transcription, we performed PCR amplification to sequence the junction region. The result was shown in the figure below. The unique sequence which can be found only in circular RNA was sequenced. From this result, even a small amount of circular RNA was synthesized.
Figure.7 Sequence result of the product of reverse transcription of circRNA
Expression speed measurement by real-time PCR machine
To consider the speed of expression, we need to invent the method to measure change in time of Fluorescence Intensity. Thus, this year we tried to measure the amount of sfGFP by Real-time PCR machine. The wavelenght of fluorescence of FAM is quite similar with GFP and we believed it was possible to consider the amount of sfGFP by Real-time PCR machine. We measured FI of fluorescein at 8 different concentration. The result was shown in the figure above.
Figure.8 Calibration curb of fluorescein
We also measured expression speed by real-time PCR machine. Speed of 5nM and1nM did not change much. We found that the initial speed of expressing can be measured.
Figure.9 Time change in fluorescence intensity
From the result of the sequence, we confirmed the synthesize of the circular RNA (circ RNA). However, the efficiency of the circularization was too low to make enough amount of circ RNA and we were not able to quantitate the amount of it. One reason for the low efficiency of the circularization is its size. The RNA we used was about twice the size of the RNA which was used in the previous study. So the RNA we used was too large. In addition, we were not able to synthesize proteins from the circ RNA. The problem with the sequence of the RNA is thought to be the cause since we were not able to synthesize even a small amount of protein from the result of the sequence of the linear RNA. In order to put circular RNA into practical use, it is necessary to review the RNA sequence and increase the efficiency of the circularization.
- Preparation of linear mRNA
KAPAHiFi DNA Polymerase (NIPPON Genetics Co., Ltd) amplified the DNA sequence following the instruction of the manufacturer. As the reverse primer, the second base from 5' end was 2-o-methylated. Linear RNA strands were prepared from the PCR products by in vitro transcription. Linear RNAs were prepared using the MEGAscript High Yield Transcription Kit (Invitrogen by Thermo Fisher Scientific, Waltham, MA, USA). An excess amount of GMP was added (7.5 mM, 15 mM, 30 mM to 1.5 mM GTP) to make the in vitro transcripts mono-phosphorylated. After incubation, the reaction was treated with DNase to remove the DNA template. The linear RNA was purified by MEGAclear (Invitrogen by Thermo Fisher Scientific, Waltham, MA, USA).
- Circularization of mRNA
Transcribed linear RNA was circularized using T4 RNA ligase 2 (New England Biolabs) on a guide DNA. After mixing the RNA solution with the guide DNA and the buffer, the mixture was incubated at 98 °C for 5 mins and cooled at room temperature. linear RNA (0.2 μM, 0.5 μM, 1 μM) was heated with T4 RNA ligase 2 in a mixture of 50 mM Tris-HCl (pH 7.5), 2 mM MgCl2, 1 mM DTT and 0.4 mM ATP at 37 °C for 3 h.
- Circularity check by exonuclease
RNase R (1 unit/uL: abm Inc., Vancouver, Canada) degraded the linear RNA in the buffer provided by the company for 10 mins at 37 °C. The reaction mixture (5 μL) was analyzed by 10% denaturing PAGE.
- Expression of sfGFP in PURE system
Circular RNA was mixed with PUREfrex (GeneFrontier, Chiba, Japan) and incubated for 4 h at 37°C in a volume of 20 μL following the instruction. Briefly, the proteins were separated by 5–20%SDS-PAGE and transferred to nitrocellulose membranes. For CBB staining, the GelCode Blue Safe Protein Stain (Thermo Fisher) was used. For western blotting, 5% nonfat dry milk in TBS containing 0.1% Tween-20 was used for blocking and antibody dilution. For lectin blotting, TBS containing 0.1% Tween-20 was used for the blocking and dilution of biotinylated lectin or HRP-Streptavidin (VECTASTAIN ABC Standard Kit). For streptavidin blotting, after blocking with TBS containing 0.1% Tween 20, the membranes were incubated with HRP-Streptavidin (VECTASTAIN ABC Standard Kit). Proteins were detected with Western lightning ECL Pro (PerkinElmer) using an ImageQuant LAS-4000mini (GE Healthcare).
- Expression speed measurement by real-time PCR machine
Fluorescein solution was diluted 100-fold, and we dispensed it to PCR tubes diluting from 10-2 to 10-9-fold as the control. We prepared these three sets. Second, GFP template DNA solution was diluted 1, 5, and 10-fold, and we prepared these three sets respectively with myTXTL mixture. We also prepared negative controls three sets. Finally, we carried out qPCR with all samples we prepared and assayed the quantity of GFP which DNA expressed.
- The detailed method of our protocol
All of the methods with the precise amount, primer sets and incubation time are shown in the PDF file below.
We would like to thank our PI; Professor H. IWAHAI, Professor T. YABE for general support. and other professors; Professor T. YOKOGAWA , Professor T. NAKAGAWA(Gifu University), Takashi KANAMORI, PhD, Rena MATSUMOTO, PhD (Gene Frontier), Professor H. ABE (Nagoya University), Professor Y. KIZUKA (G-CHAIN, Gifu University) for Technical support. We are grateful to President MORIWAKI & Gifu University, Cosmo Bio, Kagami reunion, Snapgene, Arbor Biosciences, Twist biosciences for various supports..
1. Gundula R et al.(1994).The mechanism of translational coupling in Escherichia coli. The Journal of Biological Chemistry, 27,18118-18127
2. Laszlo J et al.(1994). Ribosome recycling factor (ribosome releasing factor) is essential for bacterial growth. Biochemistry, 91, 4249-4253
3. Naoko A et al.(2015). Rolling Circle Translation of Circular RNA in Living Human Cells. Sci. Rep. 5, 16435; doi: 10.1038/srep16435
4.Inokuchi, Y. et al. Role of ribosome recycling factor (RRF) in translational coupling. The EMBO Journal. 19,3788-3798(2000)
5.Shimizu, Y. et al. Cell-free translational reconstituted with purified components. Nature biotechnology. 19, 751-755(2001)
6.Kao, C, Zheng, M. A simple efficient method to reduce nontemplated nucleotide addition at the 3’ terminus of RNAs transcribed by T7 RNA polymerase. RNA,5 1268-1272(1999)