Aims

We decided to characterize some of the Anderson promoters. These promoters are highly used by iGEM but the relative expression of these promoters have been routinely determined by measuring the fluorescence of a reporter protein. However, the function of a promoter is to start transcription of a gene so it may be more informative to measure the amount of RNA (instead of protein) produced by a reporter gene. Therefore, we decided to further characterize the following selection of Anderson promoters by measuring RNA using Quantitative Polymerase Chain Reaction (qPCR):

J23100
J23101
J23103
J23105
J23118

Methods

Selecting Promoters and Composite Parts

Our first step was to find a diverse group of strengths. The following strengths were measured by iGEM2006_Berkeley using RFP protein measurements.

Promoter Name	Strength	RFP in AU measured by iGEM2006_Berkeley	Plasmid Backbone
BBa_J23100	1	2547	BBa_J61002
BBa_J23101	0.70	1791	BBa_J61002
BBa_J23103	.01	17	BBa_J61002
BBa_J23105	.24	623	BBa_J61002
BBa_J23108	.56	1429	BBa_J61002

We found composite parts on distribution kit that included the promoters we chose followed by reporter gene. All of the promoters we chose were on BBa_J61002 plasmid backbone which includes RFP and Amp.

Growing Bacteria & RNA Extraction

We resuspended the DNA of these parts and transformed the DNA into bacteria. (See our Transformation protocol under Project > Protocols). From our plates, we selected colonies to grow in 3mL of LB overnight at 37 C. From the liquid culture, we extracted RNA using PureLink RNA Mini Kit. (See protocol under Project > Protocols).

Measuring RNA

In the qPCR, we will be looking at the abundance of the RFP gene. Although we attempt to load the same amount of DNA into each tube, small variations in the amount of template DNA can lead to large changes in the amount of light released. To accurately quantify the DNA, it is recommended to use an internal standard. In our case, we used a second gene, housekeeping gene rrsD (ribosomal RNA, 16S), that should be present in all of our RNA samples. We chose this gene because it was also used by 2012 Goettingen iGEM , who did a similar study and designed the primers for rrsD.

Primers for amplification of reference cDNA rrsD:

rrsD_fw: CGTCAGCTCGTGTTGTGAAATG
rrsD_rev: CGTGTGTAGCCCTGGTCGTAAG

We designed our own primers for RFP using NCBI Primer Design Tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). We aimed to amplify a 75–200 bp product with an annealing temperature of 65°C.

RFP_fw: CCGGCTGACATCCCGGACTA
RFP_rev: TGCATAACCGGACCGTCGGA

We made complementary DNA (cDNA) through Reverse Transcription. We set up samples for qPCR with three to four replicates per promoter and no template control samples to measure DNA contamination. (See our protocols under Project > Protocols).

Analyzing Data

We did data analysis using the Livak Method (a standard, comparative method) to determine the relative strength of the promoters from the qPCR data using rrSD as our reference gene and J23100 as our calibrator sample.

Example:

ΔCT(J23101) = CT(RFP, J23101) – CT(rrSD, J23101)

ΔΔCT(J23101) = ΔCT(J23101) – ΔCT(J23100)

2^(–ΔΔCT) = relative expression ratio

Results

In our first trial of qPCR (8/03/19), we were able to measure the relative strengths for J23100, J23101, J23103, and J23105 which were 1.00, 0.00, 0.81, and 1.93, respectively.

Since these strengths did not match the relative expression levels reported by iGEM2006_Berkeley, we repeated the qPCR (8/10/19) with the same cDNA. The strengths from this second trial were 1.00, 0.00, 0.37, and 0.20.

We repeated it again and the relative strengths that we got on 10/12/19 for J23100, J23101, J23103, and J23103 were 1, 0, 2.91, and .32.

Next, we made new cDNA by growing new liquid cultures, extracting RNA again, and repeating reverse transcription. From the new cDNA, we repeated the qPCR procedure two more times. The relative strengths for that we got on 9/28/19 for J23100, J23101, J23103, J23105, and J23118 were 1, 24.63, .36, 1.76, and .25.

The relative strengths that we got on 10/12/19 for J23100, J23101, J23103, and J23105 were 1, 45.97, 3.20, and 1.26. In addition we measured promoter J23118 twice and got the strengths 1.13 and 1.32.

Here is the relative promoter strengths that we got from the qPCR. Baltimore BioCrew in blue compared to the 2006 Berkeley iGEM in orange.

To support our RNA measurements we also measured fluorescence of the liquid cultures we used to extract RNA. The cultures were grown overnight so we expected the bacteria to be at the stationary phase, but we measured OD to normalize any differences in growth.

	OD	fluorescence	fluorescence divided by OD	corrected relative expression	reported relative expression
BBa_J23100	0.876	250	285.38	1	1
BBa_J23101	0.674	255	378.33	1.33	0.7
BBa_J23103	1.1	230	209.09	0.73	0.01
BBa_J23105	1.08	233	215.74	0.76	0.24
BBa_J23118	1.04	238	228.84	0.80	0.56

Conclusion

After repeating our experiment many times and trying to compare our results to 2006 Berkeley iGEM team we concluded that our data doesn’t quite match theirs. The different results in strengths could be caused by many different factors while doing our protocols. However, we have succeeded in characterizing the different strength Andersons promoters (J23100, J23101, J23103, J23105, J23118) by measuring RNA using Quantitative Polymerase Chain Reaction (qPCR). In conclusion, we successfully reached our goal in bringing new data to the characterizations of 5 different Andersons Promoters. In the future, it would be good for other iGEM teams to try to measure RNA as well so there will be a standard qPCR protocol for iGEM.

Team:Baltimore BioCrew/Measurement