Difference between revisions of "Team:Evry Paris-Saclay/Design"

Line 1: Line 1:
 
{{Evry_Paris-Saclay}}
 
{{Evry_Paris-Saclay}}
 
<html>
 
<html>
<head>
 
<img src="https://static.igem.org/mediawiki/2019/8/81/T--Evry_Paris-Saclay--GoldenGate.jpg" class="img-fluid" style="max-height:100vh; width: auto;"/>
 
</div>
 
<div class="container p-0">
 
<h1> Abstract </h1>
 
<ul>
 
<li><a href="#P1">Overview</a></li>
 
<li><a href="#P2">A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica</a></li>
 
<li><a href="#P3">The Loop assembly technique</a></li>
 
<li><a href="#P4">Conclusions</a></li>
 
<li><a href="#P5">References</a></li>
 
</ul>
 
  
<div class="pt-5" id="P1">
+
    <head>
<h1 class="mt-5">Overview</h1>
+
        <img src="https://static.igem.org/mediawiki/2019/8/81/T--Evry_Paris-Saclay--GoldenGate.jpg" class="img-fluid"
<p>
+
            style="max-height:100vh; width: auto;" />
Golden Gate [1, 2] is a powerful molecular biology technique that allows scarless assembly of a large number of DNA fragments. It makes use of type IIS restriction enzymes, such as BsaI, BsmBI, BbsI, SapI, etc., that have the peculiarity of having a recognition site outside their cutting site. This property gives several advantages during cloning:
+
        </div>
</p>
+
        <div class="container p-0">
<ul>
+
            <h1> Abstract </h1>
<li>
+
            <ul>
It allows scarless assembly: the cutting sites can be designed so that upon digestion and ligation, the final construct has only the desired sequence without the recognition sites.
+
                <li><a href="#P1">Overview</a></li>
</li>
+
                <li><a href="#P2">A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica</a></li>
<li>
+
                <li><a href="#P3">The Loop assembly technique</a></li>
It allows assembly of a large number of fragments in a defined order: the cutting sites can be diverse and generate several overhangs after digestion that can be ligated easily and specifically, based on complementarity.
+
                <li><a href="#P4">Conclusions</a></li>
</li>
+
                <li><a href="#P5">References</a></li>
<li>
+
            </ul>
It allows one pot digestion and ligation: the ligation is irreversible and the final DNA molecule will persist because there is no possibility of recreating the restriction sites. Thus, during the reaction, the final construct continues to accumulate, which increases the overall cloning efficiency.
+
</li>
+
</ul>
+
<p class="pt-3">
+
Golden Gate cloning allows great freedom in design and can employed for building custom made DNA molecules. For these reasons it was adopted by the scientific community who recognised its potential even for developing standardized and modular cloning.
+
Thus, several Golden Gate based tool kits were constructed both for prokaryotes and eukaryotes  [3-7 for example].
+
The recently published Loop assembly system [8] brings Golden Gate cloning to a higher level of  creativity and modularity as it allows recursive assembly of DNA fragments.<br>
+
<br>
+
We <b>welcome the iGEM initiative to fully support Type IIS parts that adhere to the MoClo/ PhytoBricks and Loop Type IIS assembly standards</b> for the first time in the 2019 Competition (https://2019.igem.org/Competition/New/Type_IIS).
+
In this framework, we designed a Loop assembly system dedicated to our chassis, the oleaginous yeast Yarrowia lipolytica.
+
</p>
+
</div>
+
<div class="pt-5" id="P2">
+
<h1 class="mt-5">A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica</h1>
+
  
</div>
+
            <div class="pt-5" id="P1">
<div class="pt-5" id="P3">
+
                <h1 class="mt-5">Overview</h1>
<h1 class="mt-5">The Loop assembly technique</h1>
+
                <p>
 +
                    Golden Gate [1, 2] is a powerful molecular biology technique that allows scarless assembly of a
 +
                    large number of DNA fragments. It makes use of type IIS restriction enzymes, such as BsaI, BsmBI,
 +
                    BbsI, SapI, etc., that have the peculiarity of having a recognition site outside their cutting site.
 +
                    This property gives several advantages during cloning:
 +
                    <ul>
 +
                        <li>
 +
                            It allows scarless assembly: the cutting sites can be designed so that upon digestion and
 +
                            ligation, the final construct has only the desired sequence without the recognition sites.
 +
                        </li>
 +
                        <li>
 +
                            It allows assembly of a large number of fragments in a defined order: the cutting sites can
 +
                            be
 +
                            diverse and generate several overhangs after digestion that can be ligated easily and
 +
                            specifically, based on complementarity.
 +
                        </li>
 +
                        <li>
 +
                            It allows one pot digestion and ligation: the ligation is irreversible and the final DNA
 +
                            molecule will persist because there is no possibility of recreating the restriction sites.
 +
                            Thus,
 +
                            during the reaction, the final construct continues to accumulate, which increases the
 +
                            overall
 +
                            cloning efficiency.
 +
                        </li>
 +
                    </ul>
 +
                    Golden Gate cloning allows great freedom in design and can employed for building custom made DNA
 +
                    molecules. For these reasons it was adopted by the scientific community who recognised its potential
 +
                    even for developing standardized and modular cloning.
 +
                    Thus, several Golden Gate based tool kits were constructed both for prokaryotes and eukaryotes [3-7
 +
                    for example].
 +
                    The recently published Loop assembly system [8] brings Golden Gate cloning to a higher level of
 +
                    creativity and modularity as it allows recursive assembly of DNA fragments.<br>
 +
                    <br>
 +
                    We <b>welcome the iGEM initiative to fully support Type IIS parts that adhere to the MoClo/
 +
                        PhytoBricks and Loop Type IIS assembly standards</b> for the first time in the 2019 Competition
 +
                    (https://2019.igem.org/Competition/New/Type_IIS).
 +
                    In this framework, we designed a Loop assembly system dedicated to our chassis, the oleaginous yeast
 +
                    Yarrowia lipolytica.
 +
                </p>
 +
            </div>
  
</div>
+
            <div class="pt-5" id="P2">
<div class="pt-5" id="P4">
+
                <h1 class="mt-5">A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica</h1>
<h1 class="mt-5">Conclusions</h1>
+
                <p>
 +
                    The general architecture of the Yarrowia lipolytica Loop assembly platform is depicted in Figure 1.
 +
                    It is BioBrick RFC[10]-compatible (no illegal EcoRI, XbaI, SpeI, PstI, or NotI site) and has the
 +
                    following features:
 +
                    <ul>
 +
                        <li>
 +
                            Two Zeta sequences, Zeta Up (<a
 +
                                href="http://parts.igem.org/Part:BBa_K2983000">BBa_K2983000</a>) and Zeta Down (<a
 +
                                href="http://parts.igem.org/Part:BBa_K2983001">BBa_K2983001</a>), are flanking the
 +
                            platform. Zeta sequences [9] allow random integrations in Yarrowia lipolytica Po1d strain
 +
                            JMY195 [10] or at a zeta docking platform in Po1d derivative strains like JMY2033 [11] which
 +
                            has the zeta platform at the ura3-302 locus or JMY1212 [12] which has the zeta platform at
 +
                            the leu2-270 locus.
 +
                        </li>
 +
                        <li>
 +
                            The URA3 auxotrophic selection marker [13] (<a
 +
                                href="http://parts.igem.org/Part:BBa_K2983005">BBa_K2983005</a>) which is composed of
 +
                            the URA3
 +
                            promoter (<a href="http://parts.igem.org/Part:BBa_K2983002">BBa_K2983002</a>), URA3 gene (<a
 +
                                href="http://parts.igem.org/Part:BBa_K2983003">BBa_K2983003</a>) and the
 +
                            URA3 terminator (<a href="http://parts.igem.org/Part:BBa_K2983004">BBa_K2983004</a>).
 +
                            The URA3 gene encodes the orotidine 5'-phosphate decarboxylase, an enzyme (EC. 4.1.1.23)
 +
                            that catalyzes the decarboxylation of orotidine monophosphate to uridine monophosphate in
 +
                            the pyrimidine ribonucleotide synthesis pathway. In the absence of this enzyme, the cells
 +
                            are able to grow only if uracil or uridine is supplemented in the media. The Yarrowia
 +
                            lipolytica Loop assembly platform having this auxotrophic selection marker needs to be used
 +
                            in Δura strains.
 +
                        </li>
 +
                        <li>
 +
                            Two traditional cloning sites (BamHI and HindIII) are flanking the URA3 auxotrophic
 +
                            selection marker to allow, if needed, changing it to other selection markers like LEU2 [13],
 +
                            LYS5 [14] or HygR [13].
 +
                        </li>
 +
                        <li>
 +
                            The Loop Type IIS cloning sites (triangles in Figure 1, see below for detailed information)
 +
                            and two SfiI sites in between to allow, if needed, the insertion of E. coli cloning
 +
                            selection markers like LacZalpha (<a
 +
                                href="http://parts.igem.org/Part:BBa_K2448003">BBa_K2448003</a>) or reporter RFP (<a
 +
                                href="http://parts.igem.org/Part:BBa_J04450">BBa_J04450</a>) expression
 +
                            cassettes.
 +
                        </li>
 +
                    </ul>
 +
                    <img src="https://static.igem.org/mediawiki/2019/5/57/T--Evry_Paris-Saclay--Figure1.png"
 +
                        class="img-fluid" />
 +
                    <div class="font-weight-light">Figure 1. General architecture of the Yarrowia lipolytica Type IIS
 +
                        RFC[10]-compatible Loop
 +
                        assembly platform.</div><br>
 +
                    <br>
 +
                    The Loop Type IIS cloning sites (triangles above) are a combination of BsaI and SapI restriction
 +
                    sites each with different cutting sites that generate well defined overhangs (circles in Figure 1,
 +
                    see Figure 2 for more details). A total of 50 combinations are theoretically possible and some
 +
                    relevant examples are listed in Table 1.
 +
                    <img src="https://static.igem.org/mediawiki/2019/e/eb/T--Evry_Paris-Saclay--Figure2.png"
 +
                        class="img-fluid" />
 +
                    <div class="font-weight-light">Figure 2. BsaI and SapI restriction sites (adapted from [8]).</div>
 +
                    <br>
 +
                    <br>
 +
                    Table 1. Different possible Loop Type IIS cloning sites.
 +
                    <table class="table">
 +
                        <tr>
 +
                            <td>Part name</td>
 +
                            <td>Sequence with <span class="text-danger">BsaI</span> and <span
 +
                                    class="text-primary">SapI</span> sites highlighted</td>
 +
                            <td></td>
 +
                            <td>Part number</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop Alpha-A</td>
 +
                            <td>GCTCTTCAATGAGGAGTGAGACC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/2/29/T--Evry_Paris-Saclay--Loop_Alpha-A.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983010</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop F-Beta</td>
 +
                            <td>GGTCTCACGCTAGCATGAAGAGC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/a/a4/T--Evry_Paris-Saclay--Loop_F-Beta.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983011</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop Beta-A</td>
 +
                            <td>GCTCTTCAGCAAGGAGTGAGACC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/4/40/T--Evry_Paris-Saclay--Loop_Beta-A.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983012</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop F-Gamma</td>
 +
                            <td>GGTCTCACGCTATACTGAAGAGC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/5/50/T--Evry_Paris-Saclay--Loop_F-Gamma.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983013</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop Gamma-A</td>
 +
                            <td>GCTCTTCATACAGGAGTGAGACC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/3/39/T--Evry_Paris-Saclay--Loop_Gamma-A.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983014</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop F-Epsilon</td>
 +
                            <td>GGTCTCACGCTACAGTGAAGAGC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/d/d2/T--Evry_Paris-Saclay--Loop_F-Epsilon.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983015</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop Epsilon-A</td>
 +
                            <td>GCTCTTCACAGAGGAGTGAGACC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/b/b0/T--Evry_Paris-Saclay--Loop_Epsilon-A.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983016</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop F-Omega</td>
 +
                            <td>GGTCTCACGCTAGGTTGAAGAGC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/4/4b/T--Evry_Paris-Saclay--Loop_F-Omega.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983017</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop A-alpha</td>
 +
                            <td>GGTCTCAGGAGAATGTGAAGAGC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/8/80/T--Evry_Paris-Saclay--Loop_A-Alpha.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983018</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop Omega-B</td>
 +
                            <td>GCTCTTCAGGTATACTTGAGACC</td>
 +
                            <td><img src="https://2019.igem.org/File:T--Evry_Paris-Saclay--Loop_Omega-B.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983019</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop B-Alpha</td>
 +
                            <td>GGTCTCATACTAATGTGAAGAGC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/4/42/T--Evry_Paris-Saclay--Loop_B-Alpha.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983020</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop Omega-C</td>
 +
                            <td>GCTCTTCAGGTAAATGTGAGACC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/6/62/T--Evry_Paris-Saclay--Loop_Omega-C.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983021</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop C-Alpha</td>
 +
                            <td>GGTCTCAAATGAATGTGAAGAGC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/8/8e/T--Evry_Paris-Saclay--Loop_C-Alpha.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983022</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop Omega-E</td>
 +
                            <td>GCTCTTCAGGTAGCTTTGAGACC</td>
 +
                            <td><img src="https://2019.igem.org/File:T--Evry_Paris-Saclay--Loop_Omega-E.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983023</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop E-Alpha </td>
 +
                            <td>GGTCTCAGCTTAATGTGAAGAGC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/9/9d/T--Evry_Paris-Saclay--Loop_E-Alpha.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983024</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>Loop Omega-F</td>
 +
                            <td>GCTCTTCAGGTACGCTTGAGACC</td>
 +
                            <td><img src="https://static.igem.org/mediawiki/2019/8/8f/T--Evry_Paris-Saclay--Loop_Omega-F.png"
 +
                                    class="img-fluid" /></td>
 +
                            <td>BBa_K2983025</td>
 +
                        </tr>
 +
                    </table>
 +
                </p>
 +
            </div>
 +
            <div class="pt-5" id="P3">
 +
                <h1 class="mt-5">The Loop assembly technique</h1>
  
</div>
+
            </div>
<div class="pt-5" id="P5">
+
            <div class="pt-5" id="P4">
<h1 class="mt-5">References</h1>
+
                <h1 class="mt-5">Conclusions</h1>
  
</div>
+
            </div>
 +
            <div class="pt-5" id="P5">
 +
                <h1 class="mt-5">References</h1>
  
 +
            </div>
 +
 +
 +
        </div>
 +
        </body>
 +
    </head>
  
</div>
 
</body>
 
</head>
 
 
</html>
 
</html>
 
{{Evry_Paris-Saclay/bottom}}
 
{{Evry_Paris-Saclay/bottom}}

Revision as of 22:58, 18 October 2019

Title

Abstract

Overview

Golden Gate [1, 2] is a powerful molecular biology technique that allows scarless assembly of a large number of DNA fragments. It makes use of type IIS restriction enzymes, such as BsaI, BsmBI, BbsI, SapI, etc., that have the peculiarity of having a recognition site outside their cutting site. This property gives several advantages during cloning:

  • It allows scarless assembly: the cutting sites can be designed so that upon digestion and ligation, the final construct has only the desired sequence without the recognition sites.
  • It allows assembly of a large number of fragments in a defined order: the cutting sites can be diverse and generate several overhangs after digestion that can be ligated easily and specifically, based on complementarity.
  • It allows one pot digestion and ligation: the ligation is irreversible and the final DNA molecule will persist because there is no possibility of recreating the restriction sites. Thus, during the reaction, the final construct continues to accumulate, which increases the overall cloning efficiency.
Golden Gate cloning allows great freedom in design and can employed for building custom made DNA molecules. For these reasons it was adopted by the scientific community who recognised its potential even for developing standardized and modular cloning. Thus, several Golden Gate based tool kits were constructed both for prokaryotes and eukaryotes [3-7 for example]. The recently published Loop assembly system [8] brings Golden Gate cloning to a higher level of creativity and modularity as it allows recursive assembly of DNA fragments.

We welcome the iGEM initiative to fully support Type IIS parts that adhere to the MoClo/ PhytoBricks and Loop Type IIS assembly standards for the first time in the 2019 Competition (https://2019.igem.org/Competition/New/Type_IIS). In this framework, we designed a Loop assembly system dedicated to our chassis, the oleaginous yeast Yarrowia lipolytica.

A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica

The general architecture of the Yarrowia lipolytica Loop assembly platform is depicted in Figure 1. It is BioBrick RFC[10]-compatible (no illegal EcoRI, XbaI, SpeI, PstI, or NotI site) and has the following features:

  • Two Zeta sequences, Zeta Up (BBa_K2983000) and Zeta Down (BBa_K2983001), are flanking the platform. Zeta sequences [9] allow random integrations in Yarrowia lipolytica Po1d strain JMY195 [10] or at a zeta docking platform in Po1d derivative strains like JMY2033 [11] which has the zeta platform at the ura3-302 locus or JMY1212 [12] which has the zeta platform at the leu2-270 locus.
  • The URA3 auxotrophic selection marker [13] (BBa_K2983005) which is composed of the URA3 promoter (BBa_K2983002), URA3 gene (BBa_K2983003) and the URA3 terminator (BBa_K2983004). The URA3 gene encodes the orotidine 5'-phosphate decarboxylase, an enzyme (EC. 4.1.1.23) that catalyzes the decarboxylation of orotidine monophosphate to uridine monophosphate in the pyrimidine ribonucleotide synthesis pathway. In the absence of this enzyme, the cells are able to grow only if uracil or uridine is supplemented in the media. The Yarrowia lipolytica Loop assembly platform having this auxotrophic selection marker needs to be used in Δura strains.
  • Two traditional cloning sites (BamHI and HindIII) are flanking the URA3 auxotrophic selection marker to allow, if needed, changing it to other selection markers like LEU2 [13], LYS5 [14] or HygR [13].
  • The Loop Type IIS cloning sites (triangles in Figure 1, see below for detailed information) and two SfiI sites in between to allow, if needed, the insertion of E. coli cloning selection markers like LacZalpha (BBa_K2448003) or reporter RFP (BBa_J04450) expression cassettes.
Figure 1. General architecture of the Yarrowia lipolytica Type IIS RFC[10]-compatible Loop assembly platform.


The Loop Type IIS cloning sites (triangles above) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1, see Figure 2 for more details). A total of 50 combinations are theoretically possible and some relevant examples are listed in Table 1.
Figure 2. BsaI and SapI restriction sites (adapted from [8]).


Table 1. Different possible Loop Type IIS cloning sites.
Part name Sequence with BsaI and SapI sites highlighted Part number
Loop Alpha-A GCTCTTCAATGAGGAGTGAGACC BBa_K2983010
Loop F-Beta GGTCTCACGCTAGCATGAAGAGC BBa_K2983011
Loop Beta-A GCTCTTCAGCAAGGAGTGAGACC BBa_K2983012
Loop F-Gamma GGTCTCACGCTATACTGAAGAGC BBa_K2983013
Loop Gamma-A GCTCTTCATACAGGAGTGAGACC BBa_K2983014
Loop F-Epsilon GGTCTCACGCTACAGTGAAGAGC BBa_K2983015
Loop Epsilon-A GCTCTTCACAGAGGAGTGAGACC BBa_K2983016
Loop F-Omega GGTCTCACGCTAGGTTGAAGAGC BBa_K2983017
Loop A-alpha GGTCTCAGGAGAATGTGAAGAGC BBa_K2983018
Loop Omega-B GCTCTTCAGGTATACTTGAGACC BBa_K2983019
Loop B-Alpha GGTCTCATACTAATGTGAAGAGC BBa_K2983020
Loop Omega-C GCTCTTCAGGTAAATGTGAGACC BBa_K2983021
Loop C-Alpha GGTCTCAAATGAATGTGAAGAGC BBa_K2983022
Loop Omega-E GCTCTTCAGGTAGCTTTGAGACC BBa_K2983023
Loop E-Alpha GGTCTCAGCTTAATGTGAAGAGC BBa_K2983024
Loop Omega-F GCTCTTCAGGTACGCTTGAGACC BBa_K2983025

The Loop assembly technique

Conclusions

References