TomZaplana (Talk | contribs) |
|||
(31 intermediate revisions by 3 users not shown) | |||
Line 12: | Line 12: | ||
<ul> | <ul> | ||
<li><h3><a href="#P1">Overview</a></h3></li> | <li><h3><a href="#P1">Overview</a></h3></li> | ||
− | <li><h3><a href="#P2">A Type IIS RFC[ | + | <li><h3><a href="#P2">A Type IIS RFC[1000] Loop assembly system for <i>Yarrowia lipolytica</i></a></h3></li> |
− | <li><h3><a href="# | + | <li><h3><a href="#P3">The Loop assembly technique</a></h3></li> |
− | <li><h3><a href="# | + | <li><h3><a href="#P4">Conclusions</a></h3></li> |
− | <li><h3><a href="# | + | <li><h3><a href="#P5">References</a></h3></li> |
</ul> | </ul> | ||
Line 53: | Line 53: | ||
creativity and modularity as it allows recursive assembly of DNA fragments.<br> | creativity and modularity as it allows recursive assembly of DNA fragments.<br> | ||
<br> | <br> | ||
− | + | <b>We welcome the iGEM initiative to fully support Type IIS parts that adhere to the MoClo/ | |
− | PhytoBricks and Loop Type IIS assembly standards</b> for the first time in the 2019 Competition | + | PhytoBricks and Loop Type IIS assembly standards</b> for the first time in the 2019 Competition |
− | + | ||
+ | <a href="http://parts.igem.org/Help:Standards/Assembly/Type_IIS" target="_blank">http://parts.igem.org/Help:Standards/Assembly/Type_IIS</a>.<br> | ||
+ | |||
In this framework, we designed a Loop assembly system dedicated to our chassis, the oleaginous yeast | In this framework, we designed a Loop assembly system dedicated to our chassis, the oleaginous yeast | ||
− | Yarrowia lipolytica. | + | <i>Yarrowia lipolytica</i>. |
</p> | </p> | ||
</div> | </div> | ||
+ | |||
+ | |||
+ | |||
<div class="pt-5" id="P2"> | <div class="pt-5" id="P2"> | ||
− | <h1 class="mt-5">A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica</h1> | + | <h1 class="mt-5">A Type IIS RFC[10] Loop assembly system for <i>Yarrowia lipolytica</i></h1> |
<p> | <p> | ||
− | The general architecture of the Yarrowia lipolytica Loop assembly platform is depicted in Figure 1. | + | The general architecture of the <i>Yarrowia lipolytica</i> Loop assembly platform is depicted in Figure 1. |
It is BioBrick RFC[10]-compatible (no illegal EcoRI, XbaI, SpeI, PstI, or NotI site) and has the | It is BioBrick RFC[10]-compatible (no illegal EcoRI, XbaI, SpeI, PstI, or NotI site) and has the | ||
following features: | following features: | ||
<ul> | <ul> | ||
<li> | <li> | ||
− | + | <p> Two Zeta sequences, Zeta Up (<a | |
− | href="http://parts.igem.org/Part:BBa_K2983000">BBa_K2983000</a>) and Zeta Down (<a | + | href="http://parts.igem.org/Part:BBa_K2983000" target="_blank">BBa_K2983000</a>) and Zeta Down (<a |
− | href="http://parts.igem.org/Part:BBa_K2983001">BBa_K2983001</a>), are flanking the | + | href="http://parts.igem.org/Part:BBa_K2983001" target="_blank">BBa_K2983001</a>), are flanking the |
− | platform. Zeta sequences [9] allow random integrations in Yarrowia lipolytica Po1d strain | + | platform. Zeta sequences [9] allow random integrations in <i>Yarrowia lipolytica</i> Po1d strain |
JMY195 [10] or at a zeta docking platform in Po1d derivative strains like JMY2033 [11] which | JMY195 [10] or at a zeta docking platform in Po1d derivative strains like JMY2033 [11] which | ||
− | has the zeta platform at the ura3-302 locus or JMY1212 [12] which has the zeta platform at | + | has the zeta platform at the <i>ura3-302</i> locus or JMY1212 [12] which has the zeta platform at |
− | the leu2-270 locus. | + | the <i>leu2-270</i> locus. </p> |
</li> | </li> | ||
<li> | <li> | ||
− | The URA3 auxotrophic selection marker [13] (<a | + | <p> The <i>URA3</i> auxotrophic selection marker [13] (<a |
− | href="http://parts.igem.org/Part:BBa_K2983005">BBa_K2983005</a>) which is composed of | + | href="http://parts.igem.org/Part:BBa_K2983005" target="_blank">BBa_K2983005</a>) which is composed of |
− | the URA3 | + | the <i>URA3</i> |
− | promoter (<a href="http://parts.igem.org/Part:BBa_K2983002">BBa_K2983002</a>), URA3 gene (<a | + | promoter (<a href="http://parts.igem.org/Part:BBa_K2983002" target="_blank">BBa_K2983002</a>), <i>URA3</i> gene (<a |
− | href="http://parts.igem.org/Part:BBa_K2983003">BBa_K2983003</a>) and the | + | href="http://parts.igem.org/Part:BBa_K2983003" target="_blank">BBa_K2983003</a>) and the |
− | URA3 terminator (<a href="http://parts.igem.org/Part:BBa_K2983004">BBa_K2983004</a>). | + | URA3 terminator (<a href="http://parts.igem.org/Part:BBa_K2983004" target="_blank">BBa_K2983004</a>). |
− | The URA3 gene encodes the orotidine 5'-phosphate decarboxylase, an enzyme (EC. 4.1.1.23) | + | The <i>URA3</i> gene encodes the orotidine 5'-phosphate decarboxylase, an enzyme (EC. 4.1.1.23) |
that catalyzes the decarboxylation of orotidine monophosphate to uridine monophosphate in | that catalyzes the decarboxylation of orotidine monophosphate to uridine monophosphate in | ||
the pyrimidine ribonucleotide synthesis pathway. In the absence of this enzyme, the cells | the pyrimidine ribonucleotide synthesis pathway. In the absence of this enzyme, the cells | ||
− | are able to grow only if uracil or uridine is supplemented in the media. The Yarrowia | + | are able to grow only if uracil or uridine is supplemented in the media. The <i>Yarrowia |
− | lipolytica Loop assembly platform having this auxotrophic selection marker needs to be used | + | lipolytica</i> Loop assembly platform having this auxotrophic selection marker needs to be used |
− | in | + | in Δ<i>ura</i> strains.</p> |
</li> | </li> | ||
<li> | <li> | ||
− | Two traditional cloning sites (BamHI and HindIII) are flanking the URA3 auxotrophic | + | <p> Two traditional cloning sites (BamHI and HindIII) are flanking the <i>URA3</i> auxotrophic |
− | selection marker to allow, if needed, changing it to other selection markers like LEU2 [13], | + | selection marker to allow, if needed, changing it to other selection markers like <i>LEU2</i> [13], |
− | LYS5 [14] or HygR [13]. | + | <i>LYS5</i> [14] or <i>HygR</i> [13].</p> |
</li> | </li> | ||
<li> | <li> | ||
− | The Loop Type IIS cloning sites (triangles in Figure 1, see below for detailed information) | + | <p> The Loop Type IIS cloning sites (triangles in Figure 1, see below for detailed information) |
− | and two SfiI sites in between to allow, if needed, the insertion of E. coli cloning | + | and two SfiI sites in between to allow, if needed, the insertion of <i>E. coli</i> cloning |
selection markers like LacZalpha (<a | selection markers like LacZalpha (<a | ||
− | href="http://parts.igem.org/Part:BBa_K2448003">BBa_K2448003</a>) or reporter RFP (<a | + | href="http://parts.igem.org/Part:BBa_K2448003" target="_blank">BBa_K2448003</a>) or reporter RFP (<a |
− | href="http://parts.igem.org/Part:BBa_J04450">BBa_J04450</a>) expression | + | href="http://parts.igem.org/Part:BBa_J04450" target="_blank">BBa_J04450</a>) expression |
− | cassettes. | + | cassettes.</p> |
</li> | </li> | ||
</ul> | </ul> | ||
<img src="https://static.igem.org/mediawiki/2019/5/57/T--Evry_Paris-Saclay--Figure1.png" | <img src="https://static.igem.org/mediawiki/2019/5/57/T--Evry_Paris-Saclay--Figure1.png" | ||
class="img-fluid" /> | class="img-fluid" /> | ||
− | <div class="font-weight-light">Figure 1. General architecture of the Yarrowia lipolytica Type IIS | + | |
+ | |||
+ | <div class="font-weight-light"><center>Figure 1. General architecture of the <i>Yarrowia lipolytica</i> Type IIS | ||
RFC[10]-compatible Loop | RFC[10]-compatible Loop | ||
− | assembly platform.</div><br> | + | assembly platform.</center></div><br> |
− | <br> | + | |
+ | <br> <p> | ||
The Loop Type IIS cloning sites (triangles above) are a combination of BsaI and SapI restriction | The Loop Type IIS cloning sites (triangles above) are a combination of BsaI and SapI restriction | ||
sites each with different cutting sites that generate well defined overhangs (circles in Figure 1, | sites each with different cutting sites that generate well defined overhangs (circles in Figure 1, | ||
see Figure 2 for more details). A total of 50 combinations are theoretically possible and some | see Figure 2 for more details). A total of 50 combinations are theoretically possible and some | ||
− | relevant examples are listed in Table 1. | + | relevant examples are listed in Table 1.</p> |
− | <img src="https://static.igem.org/mediawiki/2019/e/eb/T--Evry_Paris-Saclay--Figure2.png" | + | |
− | + | <center><img src="https://static.igem.org/mediawiki/2019/e/eb/T--Evry_Paris-Saclay--Figure2.png" height="500"width="500"class="img-fluid" /></center> | |
− | <div class="font-weight-light">Figure 2. BsaI and SapI restriction sites (adapted from [8]).</div> | + | <div class="font-weight-light"><center> |
+ | Figure 2. BsaI and SapI restriction sites (adapted from [8]).</center></div> | ||
<br> | <br> | ||
<br> | <br> | ||
− | Table 1. Different possible Loop Type IIS cloning sites. | + | |
+ | <div class="font-weight-light"><center>Table 1. Different possible Loop Type IIS cloning sites.</center></div> | ||
+ | |||
<table class="table m-0"> | <table class="table m-0"> | ||
<tr> | <tr> | ||
− | < | + | <th class="w-25">Part name</th> |
− | < | + | <th class="w-25">Sequence with <span class="text-danger">BsaI</span> and <span |
− | class="text-primary">SapI</span> sites highlighted</ | + | class="text-primary">SapI</span> sites highlighted</th> |
− | < | + | <th class="w-25"></th> |
− | < | + | <th class="w-25">Part number</th> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 137: | Line 148: | ||
src="https://static.igem.org/mediawiki/2019/2/29/T--Evry_Paris-Saclay--Loop_Alpha-A.png" | src="https://static.igem.org/mediawiki/2019/2/29/T--Evry_Paris-Saclay--Loop_Alpha-A.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983010</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983010" target="_blank">BBa_K2983010</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 147: | Line 158: | ||
src="https://static.igem.org/mediawiki/2019/a/a4/T--Evry_Paris-Saclay--Loop_F-Beta.png" | src="https://static.igem.org/mediawiki/2019/a/a4/T--Evry_Paris-Saclay--Loop_F-Beta.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983011</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983011" target="_blank">BBa_K2983011</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 157: | Line 168: | ||
src="https://static.igem.org/mediawiki/2019/4/40/T--Evry_Paris-Saclay--Loop_Beta-A.png" | src="https://static.igem.org/mediawiki/2019/4/40/T--Evry_Paris-Saclay--Loop_Beta-A.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983012</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983012" target="_blank">BBa_K2983012</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 167: | Line 178: | ||
src="https://static.igem.org/mediawiki/2019/5/50/T--Evry_Paris-Saclay--Loop_F-Gamma.png" | src="https://static.igem.org/mediawiki/2019/5/50/T--Evry_Paris-Saclay--Loop_F-Gamma.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983013</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983013" target="_blank">BBa_K2983013</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">Loop Gamma-A</td> | <td class="w-25">Loop Gamma-A</td> | ||
− | <td class="w-25"><span class="text- | + | <td class="w-25"><span class="text-primary">GCTCTTC</span>A<span |
− | class="text- | + | class="text-primary">TAC</span>A<span class="text-danger">GGAG</span>T<span |
class="text-danger">GAGAC</span>C</td> | class="text-danger">GAGAC</span>C</td> | ||
<td class="w-25"><img | <td class="w-25"><img | ||
src="https://static.igem.org/mediawiki/2019/3/39/T--Evry_Paris-Saclay--Loop_Gamma-A.png" | src="https://static.igem.org/mediawiki/2019/3/39/T--Evry_Paris-Saclay--Loop_Gamma-A.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983014</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983014" target="_blank">BBa_K2983014</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 187: | Line 198: | ||
src="https://static.igem.org/mediawiki/2019/d/d2/T--Evry_Paris-Saclay--Loop_F-Epsilon.png" | src="https://static.igem.org/mediawiki/2019/d/d2/T--Evry_Paris-Saclay--Loop_F-Epsilon.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983015</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983015" target="_blank">BBa_K2983015</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 197: | Line 208: | ||
src="https://static.igem.org/mediawiki/2019/b/b0/T--Evry_Paris-Saclay--Loop_Epsilon-A.png" | src="https://static.igem.org/mediawiki/2019/b/b0/T--Evry_Paris-Saclay--Loop_Epsilon-A.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983016</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983016" target="_blank">BBa_K2983016</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 207: | Line 218: | ||
src="https://static.igem.org/mediawiki/2019/4/4b/T--Evry_Paris-Saclay--Loop_F-Omega.png" | src="https://static.igem.org/mediawiki/2019/4/4b/T--Evry_Paris-Saclay--Loop_F-Omega.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983017</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983017" target="_blank">BBa_K2983017</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 217: | Line 228: | ||
src="https://static.igem.org/mediawiki/2019/8/80/T--Evry_Paris-Saclay--Loop_A-Alpha.png" | src="https://static.igem.org/mediawiki/2019/8/80/T--Evry_Paris-Saclay--Loop_A-Alpha.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983018</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983018" target="_blank">BBa_K2983018</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 225: | Line 236: | ||
class="text-danger">GAGACC</span></td> | class="text-danger">GAGACC</span></td> | ||
<td class="w-25"><img | <td class="w-25"><img | ||
− | src="https:// | + | src="https://static.igem.org/mediawiki/2019/e/ef/T--Evry_Paris-Saclay--Loop_Omega-B.png" |
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983019</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983019" target="_blank">BBa_K2983019</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 237: | Line 248: | ||
src="https://static.igem.org/mediawiki/2019/4/42/T--Evry_Paris-Saclay--Loop_B-Alpha.png" | src="https://static.igem.org/mediawiki/2019/4/42/T--Evry_Paris-Saclay--Loop_B-Alpha.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983020</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983020" target="_blank">BBa_K2983020</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 247: | Line 258: | ||
src="https://static.igem.org/mediawiki/2019/6/62/T--Evry_Paris-Saclay--Loop_Omega-C.png" | src="https://static.igem.org/mediawiki/2019/6/62/T--Evry_Paris-Saclay--Loop_Omega-C.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983021</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983021" target="_blank">BBa_K2983021</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 257: | Line 268: | ||
src="https://static.igem.org/mediawiki/2019/8/8e/T--Evry_Paris-Saclay--Loop_C-Alpha.png" | src="https://static.igem.org/mediawiki/2019/8/8e/T--Evry_Paris-Saclay--Loop_C-Alpha.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983022</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983022" target="_blank">BBa_K2983022</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 267: | Line 278: | ||
src="https://static.igem.org/mediawiki/2019/d/d3/T--Evry_Paris-Saclay--Loop_Omega-E.png" | src="https://static.igem.org/mediawiki/2019/d/d3/T--Evry_Paris-Saclay--Loop_Omega-E.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983023</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983023" target="_blank">BBa_K2983023</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 277: | Line 288: | ||
src="https://static.igem.org/mediawiki/2019/9/9d/T--Evry_Paris-Saclay--Loop_E-Alpha.png" | src="https://static.igem.org/mediawiki/2019/9/9d/T--Evry_Paris-Saclay--Loop_E-Alpha.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983024</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983024" target="_blank">BBa_K2983024</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 287: | Line 298: | ||
src="https://static.igem.org/mediawiki/2019/8/8f/T--Evry_Paris-Saclay--Loop_Omega-F.png" | src="https://static.igem.org/mediawiki/2019/8/8f/T--Evry_Paris-Saclay--Loop_Omega-F.png" | ||
class="img-fluid" /></td> | class="img-fluid" /></td> | ||
− | <td class="w-25">BBa_K2983025</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983025" target="_blank">BBa_K2983025</a></td> |
</tr> | </tr> | ||
</table> | </table> | ||
− | + | <br> | |
+ | <p>By an ingenious combination of the two Loop sites, Pollak <i>et al.</i> [8] developed a set of vectors that | ||
allow assembly of individual parts: <b>Promoters, 5’UTR, CDS, and Terminators</b> (<b>Level 0</b> | allow assembly of individual parts: <b>Promoters, 5’UTR, CDS, and Terminators</b> (<b>Level 0</b> | ||
parts) into | parts) into | ||
Line 299: | Line 311: | ||
parts).<br> | parts).<br> | ||
<br> | <br> | ||
− | Based on the general architecture of our Yarrowia lipolytica Loop assembly platform (Figure 1), we | + | Based on the general architecture of our <i>Yarrowia lipolytica</i> Loop assembly platform (Figure 1), we |
− | designed the | + | designed the YL-pOdd (Table 3) and YL-pEven plasmids (Table 4) that allow the same modularity |
for the assembly of complex genetic circuits and further are able to integrate into the oleaginous | for the assembly of complex genetic circuits and further are able to integrate into the oleaginous | ||
− | yeast genome.< | + | yeast genome.</p> |
<br> | <br> | ||
− | Table 2. Yarrowia lipolytica Loop assembly plasmids | + | <div class="font-weight-light"><center>Table 2 . <i>Yarrowia lipolytica</i> Loop assembly plasmids YL-pOdd.</center></div> |
+ | |||
<table class="table m-0"> | <table class="table m-0"> | ||
<tr> | <tr> | ||
− | < | + | <th class="w-25">Part Name</th> |
− | < | + | <th class="w-25">Loop sites</th> |
− | < | + | <th class="w-25">Part Number</th> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pOdd1</td> | <td class="w-25">YL-pOdd1</td> | ||
<td class="w-25">Loop Alpha-A & Loop F-Beta</td> | <td class="w-25">Loop Alpha-A & Loop F-Beta</td> | ||
− | <td class="w-25">BBa_K2983030</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983030" target="_blank">BBa_K2983030</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pOdd2</td> | <td class="w-25">YL-pOdd2</td> | ||
<td class="w-25">Loop Beta-A & Loop F-Gamma</td> | <td class="w-25">Loop Beta-A & Loop F-Gamma</td> | ||
− | <td class="w-25">BBa_K2983031</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983031" target="_blank">BBa_K2983031</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pOdd3</td> | <td class="w-25">YL-pOdd3</td> | ||
<td class="w-25">Loop Gamma-A & Loop F-Epsilon</td> | <td class="w-25">Loop Gamma-A & Loop F-Epsilon</td> | ||
− | <td class="w-25">BBa_K2983032</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983032" target="_blank">BBa_K2983032</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pOdd4</td> | <td class="w-25">YL-pOdd4</td> | ||
<td class="w-25">Loop Epsilon-A & Loop F-Omega</td> | <td class="w-25">Loop Epsilon-A & Loop F-Omega</td> | ||
− | <td class="w-25">BBa_K2983033</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983033" target="_blank">BBa_K2983033</a></td> |
</tr> | </tr> | ||
</table> | </table> | ||
<br> | <br> | ||
− | + | ||
− | Multi-Transcriptional units. | + | <div class="font-weight-light"><center>Table 3. <i>Yarrowia lipolytica</i> Loop assembly plasmids YL-pEven that allow assembly of 4 genes |
+ | Multi-Transcriptional units.</center></div> | ||
+ | |||
<table class="table m-0"> | <table class="table m-0"> | ||
<tr> | <tr> | ||
− | < | + | <th class="w-25">Part Name</th> |
− | < | + | <th class="w-25">Loop sites</th> |
− | < | + | <th class="w-25">Part Number</th> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pEven1</td> | <td class="w-25">YL-pEven1</td> | ||
<td class="w-25">Loop A-Alpha & Loop Omega-B</td> | <td class="w-25">Loop A-Alpha & Loop Omega-B</td> | ||
− | <td class="w-25">BBa_K2983036</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983036" target="_blank">BBa_K2983036</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pEven2</td> | <td class="w-25">YL-pEven2</td> | ||
<td class="w-25">Loop B-Alpha & Loop Omega-C</td> | <td class="w-25">Loop B-Alpha & Loop Omega-C</td> | ||
− | <td class="w-25">BBa_K2983037</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983037" target="_blank">BBa_K2983037</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pEven3</td> | <td class="w-25">YL-pEven3</td> | ||
<td class="w-25">Loop C-Alpha & Loop Omega-E</td> | <td class="w-25">Loop C-Alpha & Loop Omega-E</td> | ||
− | <td class="w-25">BBa_K2983038</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983038" target="_blank">BBa_K2983038</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pEven4</td> | <td class="w-25">YL-pEven4</td> | ||
<td class="w-25">Loop E-Alpha & Loop Omega-F</td> | <td class="w-25">Loop E-Alpha & Loop Omega-F</td> | ||
− | <td class="w-25">BBa_K2983039</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983039" target="_blank">BBa_K2983039</a></td> |
</tr> | </tr> | ||
− | </table> | + | </table><br><p> |
+ | |||
In addition, we expand the initial panel of combinations of two Loop sites described by Pollak et | In addition, we expand the initial panel of combinations of two Loop sites described by Pollak et | ||
al. [8] to allow assembly into Multi-Transcriptional units composed of not just 4 (as done in [8]) | al. [8] to allow assembly into Multi-Transcriptional units composed of not just 4 (as done in [8]) | ||
− | but also of 2 or 3 genes at the Even Level (Table 4). | + | but also of 2 or 3 genes at the Even Level (Table 4).</p><br> |
− | + | ||
− | Table | + | <div class="font-weight-light"><center>Table 4. <i>Yarrowia lipolytica</i> Loop assembly plasmids YL-pEven that allow assembly of 4 genes |
− | Multi-Transcriptional units. | + | Multi-Transcriptional units.</center></div> |
+ | |||
<table class="table m-0"> | <table class="table m-0"> | ||
<tr> | <tr> | ||
− | < | + | <th class="w-25">Part Name</th> |
− | < | + | <th class="w-25">Loop sites</th> |
− | < | + | <th class="w-25">Part Number</th> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pOdd5</td> | <td class="w-25">YL-pOdd5</td> | ||
<td class="w-25">Loop Beta-A & Loop F-Omega</td> | <td class="w-25">Loop Beta-A & Loop F-Omega</td> | ||
− | <td class="w-25">BBa_K2983034</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983034" target="_blank">BBa_K2983034</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td class="w-25">YL-pOdd6</td> | <td class="w-25">YL-pOdd6</td> | ||
<td class="w-25">Loop Gamma-A & Loop F-Omega</td> | <td class="w-25">Loop Gamma-A & Loop F-Omega</td> | ||
− | <td class="w-25">BBa_K2983035</td> | + | <td class="w-25"><a href="http://parts.igem.org/Part:BBa_K2983035" target="_blank">BBa_K2983035</a></td> |
</tr> | </tr> | ||
</table> | </table> | ||
Line 389: | Line 406: | ||
<div class="pt-5" id="P3"> | <div class="pt-5" id="P3"> | ||
<h1 class="mt-5">The Loop assembly technique</h1> | <h1 class="mt-5">The Loop assembly technique</h1> | ||
− | + | <P> The empty YL-pOdd backbones (Table 2) allow the insertion of one combination of a Promoter, a 5’UTR, a | |
CDS and a Terminator in order to form a Transcriptional unit (Level 1 / Odd level). The assembly is made | CDS and a Terminator in order to form a Transcriptional unit (Level 1 / Odd level). The assembly is made | ||
− | by Golden Gate using BsaI as restriction enzyme, the acceptor | + | by Golden Gate using BsaI as restriction enzyme, the acceptor YL-pOdd plasmid as backbone, and the 4 |
different individual parts flanked by BsaI sites with compatible cutting sites from the Level 0 plasmid | different individual parts flanked by BsaI sites with compatible cutting sites from the Level 0 plasmid | ||
set as inserts (Figure 3). However, in eukaryotes the Promoter and the 5’UTR are often not clearly | set as inserts (Figure 3). However, in eukaryotes the Promoter and the 5’UTR are often not clearly | ||
differentiated (since the boundary between the Promoter and the 5’UTR is not precise). Therefore, in | differentiated (since the boundary between the Promoter and the 5’UTR is not precise). Therefore, in | ||
this case, the Level 1 assembly is performed with only 3 fragments. | this case, the Level 1 assembly is performed with only 3 fragments. | ||
− | The choice of | + | The choice of YL-pOdd backbone to be used is dictated by the position of the gene in the |
− | multi-transcriptional unit at Level 2 (Even level): | + | multi-transcriptional unit at Level 2 (Even level): </p><ul> |
− | + | ||
− | + | ||
− | + | ||
<li> | <li> | ||
− | pOdd1: for the assembly of Transcriptional units that will be in Position 1 at the Even Level | + | <p>pOdd1: for the assembly of Transcriptional units that will be in Position 1 at the Even Level</p> |
</li> | </li> | ||
<li> | <li> | ||
− | pOdd2: for the assembly of Transcriptional units that will be in Position 2 at the Even Level | + | <p>pOdd2: for the assembly of Transcriptional units that will be in Position 2 at the Even Level |
− | Multi-Transcriptional units composed of 3 or 4 genes | + | Multi-Transcriptional units composed of 3 or 4 genes</p> |
</li> | </li> | ||
<li> | <li> | ||
− | pOdd3: for the assembly of Transcriptional units that will be in Position 3 at the Even Level | + | <p>pOdd3: for the assembly of Transcriptional units that will be in Position 3 at the Even Level |
− | Multi-Transcriptional units composed of 4 genes | + | Multi-Transcriptional units composed of 4 genes</p> |
</li> | </li> | ||
<li> | <li> | ||
− | pOdd4: for the assembly of Transcriptional units that will be in Position 4 at the Even Level | + | <p>pOdd4: for the assembly of Transcriptional units that will be in Position 4 at the Even Level |
− | Multi-Transcriptional units composed of 4 genes | + | Multi-Transcriptional units composed of 4 genes</p> |
</li> | </li> | ||
<li> | <li> | ||
− | pOdd5: for the assembly of Transcriptional units that will be in Position 2 at the Even Level | + | <p>pOdd5: for the assembly of Transcriptional units that will be in Position 2 at the Even Level |
− | Multi-Transcriptional units composed of 2 genes | + | Multi-Transcriptional units composed of 2 genes</p> |
</li> | </li> | ||
<li> | <li> | ||
− | pOdd6: for the assembly of Transcriptional units that will be in Position 3 at the Even Level | + | <p>pOdd6: for the assembly of Transcriptional units that will be in Position 3 at the Even Level |
− | Multi-Transcriptional units composed of 3 genes | + | Multi-Transcriptional units composed of 3 genes</p> |
</li> | </li> | ||
− | </ul> | + | </ul></p> |
+ | |||
<div class="row"> | <div class="row"> | ||
<div class="col"> | <div class="col"> | ||
− | <img src="https://static.igem.org/mediawiki/2019/a/ae/T--Evry_Paris-Saclay--Figure3-pOdd1.png" | + | <img src="https://static.igem.org/mediawiki/2019/a/ae/T--Evry_Paris-Saclay--Figure3-pOdd1.png"height="500"width="500" |
class="img-fluid"> | class="img-fluid"> | ||
</div> | </div> | ||
<div class="col"> | <div class="col"> | ||
− | <img src="https://static.igem.org/mediawiki/2019/0/0b/T--Evry_Paris-Saclay--Figure3-pOdd2.png" | + | <img src="https://static.igem.org/mediawiki/2019/0/0b/T--Evry_Paris-Saclay--Figure3-pOdd2.png"height="500"width="500" |
class="img-fluid"> | class="img-fluid"> | ||
</div> | </div> | ||
</div> | </div> | ||
− | Figure 3. Assembly of Level 1 (Odd level) Transcriptional units using BsaI (adapted from [8]).< | + | <br> |
+ | <div class="font-weight-light"><center>Figure 3. Assembly of Level 1 (Odd level) Transcriptional units using BsaI (adapted from [8]).</center></div> | ||
<br> | <br> | ||
− | The Level 1 Transcriptional units can be assembled into Multi-Transcriptional units (Level 2 or Even | + | <p> The Level 1 Transcriptional units can be assembled into Multi-Transcriptional units (Level 2 or Even |
Level parts) by Golden Gate using SapI as restriction enzyme (Figure 4). | Level parts) by Golden Gate using SapI as restriction enzyme (Figure 4). | ||
− | The choice of | + | The choice of YL-pOdd backbone to be used is dictated by the number of Level 1 Transcriptional units |
− | to be assembled and the position in the Multi-multi-transcriptional unit at Level 3 (Odd level). | + | to be assembled and the position in the Multi-multi-transcriptional unit at Level 3 (Odd level).</p> |
+ | <br> | ||
<div class="row"> | <div class="row"> | ||
<div class="col"> | <div class="col"> | ||
− | <img src="https://static.igem.org/mediawiki/2019/9/9f/T--Evry_Paris-Saclay--Figure4-pEven1.png" | + | <img src="https://static.igem.org/mediawiki/2019/9/9f/T--Evry_Paris-Saclay--Figure4-pEven1.png"height="500"width="500" |
class="img-fluid"> | class="img-fluid"> | ||
</div> | </div> | ||
<div class="col"> | <div class="col"> | ||
− | <img src="https://static.igem.org/mediawiki/2019/6/67/T--Evry_Paris-Saclay--Figure4-pEven2.png" | + | <img src="https://static.igem.org/mediawiki/2019/6/67/T--Evry_Paris-Saclay--Figure4-pEven2.png"height="500"width="500" |
class="img-fluid"> | class="img-fluid"> | ||
</div> | </div> | ||
<div class="col"> | <div class="col"> | ||
− | <img src="https://static.igem.org/mediawiki/2019/c/c9/T--Evry_Paris-Saclay--Figure4-pEven3.png" | + | <img src="https://static.igem.org/mediawiki/2019/c/c9/T--Evry_Paris-Saclay--Figure4-pEven3.png"height="500"width="500" |
class="img-fluid"> | class="img-fluid"> | ||
</div> | </div> | ||
</div> | </div> | ||
− | + | <br> | |
+ | |||
+ | <div class="font-weight-light"><center>Figure 4. Assembly of Level 2 (Even level) Transcriptional units using SapI (adapted from [8]).</center></div> | ||
</div> | </div> | ||
<div class="pt-5" id="P4"> | <div class="pt-5" id="P4"> | ||
<h1 class="mt-5">Conclusions</h1> | <h1 class="mt-5">Conclusions</h1> | ||
− | + | <p>We have designed a Loop assembly system for the oleaginous yeast <i>Yarrowia lipolytica</i> that makes fast and | |
efficient cloning possible by Golden Gate. It offers modularity for assembling complex genetic circuits | efficient cloning possible by Golden Gate. It offers modularity for assembling complex genetic circuits | ||
− | and their subsequent transfer and integration into the Yarrowia lipolytica genome. | + | and their subsequent transfer and integration into the <i>Yarrowia lipolytica</i> genome.</p> |
− | Using the YL-pOdd1 plasmid, we were able to derive several Level 1 transcriptional units that we | + | <p>Using the YL-pOdd1 plasmid, we were able to derive several Level 1 transcriptional units that we |
− | characterized in Yarrowia lipolytica (the details are available on dedicated pages of this wiki: | + | characterized in <i>Yarrowia lipolytica</i> (the details are available on dedicated pages of this wiki: |
− | <a href="https://2019.igem.org/Team:Evry_Paris-Saclay/Improve">Promoters & Fluorescent Proteins</a> & <a | + | <a href="https://2019.igem.org/Team:Evry_Paris-Saclay/Improve" target="_blank">Promoters & Fluorescent Proteins</a> & <a href="https://2019.igem.org/Team:Evry_Paris-Saclay/Demonstrate" target="_blank">Bioproduction</a>). Moreover, |
− | + | different other <i>Yarrowia lipolytica</i> genome | |
− | different other Yarrowia lipolytica genome | + | |
integration sequences and auxotrophic selection markers are known and can be used to further expand this | integration sequences and auxotrophic selection markers are known and can be used to further expand this | ||
− | Loop assembly system. | + | Loop assembly system.</p> |
− | This platform facilitates future cloning of genetic constructs for Yarrowia lipolytica and makes it more | + | <p>This platform facilitates future cloning of genetic constructs for <i>Yarrowia lipolytica</i> and makes it more |
− | accessible to the scientific community in general, and the iGEM community in particular. | + | accessible to the scientific community in general, and the iGEM community in particular.</p> |
</div> | </div> | ||
<div class="pt-5" id="P5"> | <div class="pt-5" id="P5"> | ||
Line 480: | Line 498: | ||
method based on type IIs restriction enzymes. PLoS One (2009) 4, e5553. | method based on type IIs restriction enzymes. PLoS One (2009) 4, e5553. | ||
<br><small class="mr-2">[3]</small>Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized | <br><small class="mr-2">[3]</small>Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized | ||
− | assembly of multigene constructs. PLoS | + | assembly of multigene constructs. PLoS One (2011) 6, e16765. |
<br><small class="mr-2">[4]</small>Sarrion-Perdigones A, Vazquez-Vilar M, Palacı J, Castelijns B, Forment J, Ziarsolo P, Blanca J, | <br><small class="mr-2">[4]</small>Sarrion-Perdigones A, Vazquez-Vilar M, Palacı J, Castelijns B, Forment J, Ziarsolo P, Blanca J, | ||
Granell A, Orzaez D. GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic | Granell A, Orzaez D. GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic | ||
biology. Plant Physiology (2013) 162, 1618–1631. | biology. Plant Physiology (2013) 162, 1618–1631. | ||
<br><small class="mr-2">[5]</small>Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. EcoFlex: a multifunctional | <br><small class="mr-2">[5]</small>Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. EcoFlex: a multifunctional | ||
− | MoClo kit for E. coli synthetic biology. ACS Synth Biol (2016) 5, 1059-1069. | + | MoClo kit for <i>E. coli</i> synthetic biology. ACS Synth Biol (2016) 5, 1059-1069. |
<br><small class="mr-2">[6]</small>Celińska E, Ledesma-Amaro R, Larroude M, Rossignol T, Pauthenier C, Nicaud JM. Golden Gate Assembly | <br><small class="mr-2">[6]</small>Celińska E, Ledesma-Amaro R, Larroude M, Rossignol T, Pauthenier C, Nicaud JM. Golden Gate Assembly | ||
− | system dedicated to complex pathway manipulation in Yarrowia lipolytica. Microb Biotechnol (2017) 10, | + | system dedicated to complex pathway manipulation in <i>Yarrowia lipolytica</i>. Microb Biotechnol (2017) 10, |
450-455. | 450-455. | ||
<br><small class="mr-2">[7]</small>Larroude M, Park YK, Soudier P, Kubiak M, Nicaud JM, Rossignol T. A modular Golden Gate toolkit for | <br><small class="mr-2">[7]</small>Larroude M, Park YK, Soudier P, Kubiak M, Nicaud JM, Rossignol T. A modular Golden Gate toolkit for | ||
− | Yarrowia lipolytica synthetic biology. Microb Biotechnol (2019) | + | <i>Yarrowia lipolytica</i> synthetic biology. Microb Biotechnol (2019) 12, 1249-1259. |
<br><small class="mr-2">[8]</small>Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, | <br><small class="mr-2">[8]</small>Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, | ||
Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New | Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New | ||
Phytol (2019) 222, 628-640. | Phytol (2019) 222, 628-640. | ||
<br><small class="mr-2">[9]</small>Pignède G, Wang HJ, Fudalej F, Seman M, Gaillardin C, Nicaud JM. Autocloning and amplification of | <br><small class="mr-2">[9]</small>Pignède G, Wang HJ, Fudalej F, Seman M, Gaillardin C, Nicaud JM. Autocloning and amplification of | ||
− | LIP2 in Yarrowia lipolytica. Appl Environ Microbiol (2000) 66, 3283-3289. | + | <i>LIP2</i> in <i>Yarrowia lipolytica</i>. Appl Environ Microbiol (2000) 66, 3283-3289. |
− | [10] Barth G, Gaillardin C. Yarrowia lipolytica. In: Wolf K (ed) Non conventional yeasts in | + | <br><small class="mr-2">[10]</small>Barth G, Gaillardin C. <i>Yarrowia lipolytica</i>. In: Wolf K (ed) Non conventional yeasts in |
biotechnology. Springer, Berlin (1996) 1, 314-388. | biotechnology. Springer, Berlin (1996) 1, 314-388. | ||
<br><small class="mr-2">[11]</small>Lazar Z, Rossignol T, Verbeke J, Crutz-Le Coq AM, Nicaud JM, Robak M. Optimized invertase | <br><small class="mr-2">[11]</small>Lazar Z, Rossignol T, Verbeke J, Crutz-Le Coq AM, Nicaud JM, Robak M. Optimized invertase | ||
− | expression and secretion cassette for improving Yarrowia lipolytica growth on sucrose for industrial | + | expression and secretion cassette for improving <i>Yarrowia lipolytica</i> growth on sucrose for industrial |
− | applications. J Ind Microbiol Biotechnol (2013) 40, 1273- | + | applications. J Ind Microbiol Biotechnol (2013) 40, 1273-1283. |
<br><small class="mr-2">[12]</small>Bordes F, Fudalej F, Dossat V, Nicaud JM, Marty A. A new recombinant protein expression system for | <br><small class="mr-2">[12]</small>Bordes F, Fudalej F, Dossat V, Nicaud JM, Marty A. A new recombinant protein expression system for | ||
− | high-throughput screening in the yeast Yarrowia lipolytica. J Microbiol Methods (2007) 70, 493-502. | + | high-throughput screening in the yeast <i>Yarrowia lipolytica</i>. J Microbiol Methods (2007) 70, 493-502. |
<br><small class="mr-2">[13]</small>Fickers P, Le Dall MT, Gaillardin C, Thonart P, Nicaud JM. New disruption cassettes for rapid gene | <br><small class="mr-2">[13]</small>Fickers P, Le Dall MT, Gaillardin C, Thonart P, Nicaud JM. New disruption cassettes for rapid gene | ||
− | disruption and marker rescue in the yeast Yarrowia lipolytica. J Microbiol Methods (2003) 55, 727-737. | + | disruption and marker rescue in the yeast <i>Yarrowia lipolytica</i>. J Microbiol Methods (2003) 55, 727-737. |
− | <br><small class="mr-2">[14]</small>Xuan JW, Fournier P, Declerck N, Chasles M, Gaillardin C. Overlapping reading frames at the LYS5 | + | <br><small class="mr-2">[14]</small>Xuan JW, Fournier P, Declerck N, Chasles M, Gaillardin C. Overlapping reading frames at the <i>LYS5</i> |
− | locus in the yeast Yarrowia lipolytica. Mol Cell Biol (1990) 10, 4795-4806. | + | locus in the yeast <i>Yarrowia lipolytica</i>. Mol Cell Biol (1990) 10, 4795-4806. |
</div> | </div> | ||
Latest revision as of 23:42, 14 December 2019
![](https://static.igem.org/mediawiki/2019/9/95/T--Evry_Paris-Saclay--BanniereLoopAssembly.png
)
Overview
A Type IIS RFC[1000] Loop assembly system for Yarrowia lipolytica
The Loop assembly technique
Conclusions
References
Overview
Golden Gate [1, 2] is a powerful molecular biology technique that allows scarless assembly of a large number of DNA fragments. It makes use of type IIS restriction enzymes, such as BsaI, BsmBI, BbsI, SapI, etc., that have the peculiarity of having a recognition site outside their cutting site. This property gives several advantages during cloning:
It allows scarless assembly: the cutting sites can be designed so that upon digestion and ligation, the final construct has only the desired sequence without the recognition sites.
-
It allows assembly of a large number of fragments in a defined order: the cutting sites can be diverse and generate several overhangs after digestion that can be ligated easily and specifically, based on complementarity.
-
It allows one pot digestion and ligation: the ligation is irreversible and the final DNA molecule will persist because there is no possibility of recreating the restriction sites. Thus, during the reaction, the final construct continues to accumulate, which increases the overall cloning efficiency.
Golden Gate cloning allows great freedom in design and can employed for building custom made DNA
molecules. For these reasons it was adopted by the scientific community who recognised its potential
even for developing standardized and modular cloning.
Thus, several Golden Gate based tool kits were constructed both for prokaryotes and eukaryotes [3-7
for example].
The recently published Loop assembly system [8] brings Golden Gate cloning to a higher level of
creativity and modularity as it allows recursive assembly of DNA fragments.
We welcome the iGEM initiative to fully support Type IIS parts that adhere to the MoClo/
PhytoBricks and Loop Type IIS assembly standards for the first time in the 2019 Competition
http://parts.igem.org/Help:Standards/Assembly/Type_IIS.
In this framework, we designed a Loop assembly system dedicated to our chassis, the oleaginous yeast
Yarrowia lipolytica.
A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica
The general architecture of the Yarrowia lipolytica Loop assembly platform is depicted in Figure 1. It is BioBrick RFC[10]-compatible (no illegal EcoRI, XbaI, SpeI, PstI, or NotI site) and has the following features:
-
Two Zeta sequences, Zeta Up (BBa_K2983000) and Zeta Down (BBa_K2983001), are flanking the platform. Zeta sequences [9] allow random integrations in Yarrowia lipolytica Po1d strain JMY195 [10] or at a zeta docking platform in Po1d derivative strains like JMY2033 [11] which has the zeta platform at the ura3-302 locus or JMY1212 [12] which has the zeta platform at the leu2-270 locus.
-
The URA3 auxotrophic selection marker [13] (BBa_K2983005) which is composed of the URA3 promoter (BBa_K2983002), URA3 gene (BBa_K2983003) and the URA3 terminator (BBa_K2983004). The URA3 gene encodes the orotidine 5'-phosphate decarboxylase, an enzyme (EC. 4.1.1.23) that catalyzes the decarboxylation of orotidine monophosphate to uridine monophosphate in the pyrimidine ribonucleotide synthesis pathway. In the absence of this enzyme, the cells are able to grow only if uracil or uridine is supplemented in the media. The Yarrowia lipolytica Loop assembly platform having this auxotrophic selection marker needs to be used in Δura strains.
-
Two traditional cloning sites (BamHI and HindIII) are flanking the URA3 auxotrophic selection marker to allow, if needed, changing it to other selection markers like LEU2 [13], LYS5 [14] or HygR [13].
-
The Loop Type IIS cloning sites (triangles in Figure 1, see below for detailed information) and two SfiI sites in between to allow, if needed, the insertion of E. coli cloning selection markers like LacZalpha (BBa_K2448003) or reporter RFP (BBa_J04450) expression cassettes.
![](https://static.igem.org/mediawiki/2019/5/57/T--Evry_Paris-Saclay--Figure1.png)
The Loop Type IIS cloning sites (triangles above) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1, see Figure 2 for more details). A total of 50 combinations are theoretically possible and some relevant examples are listed in Table 1.
![](https://static.igem.org/mediawiki/2019/e/eb/T--Evry_Paris-Saclay--Figure2.png)
Part name | Sequence with BsaI and SapI sites highlighted | Part number | |
---|---|---|---|
Loop Alpha-A | GCTCTTCAATGAGGAGTGAGACC | ![]() |
BBa_K2983010 |
Loop F-Beta | GGTCTCACGCTAGCATGAAGAGC | ![]() |
BBa_K2983011 |
Loop Beta-A | GCTCTTCAGCAAGGAGTGAGACC | ![]() |
BBa_K2983012 |
Loop F-Gamma | GGTCTCACGCTATACTGAAGAGC | ![]() |
BBa_K2983013 |
Loop Gamma-A | GCTCTTCATACAGGAGTGAGACC | ![]() |
BBa_K2983014 |
Loop F-Epsilon | GGTCTCACGCTACAGTGAAGAGC | ![]() |
BBa_K2983015 |
Loop Epsilon-A | GCTCTTCACAGAGGAGTGAGACC | ![]() |
BBa_K2983016 |
Loop F-Omega | GGTCTCACGCTAGGTTGAAGAGC | ![]() |
BBa_K2983017 |
Loop A-alpha | GGTCTCAGGAGAATGTGAAGAGC | ![]() |
BBa_K2983018 |
Loop Omega-B | GCTCTTCAGGTATACTTGAGACC | ![]() |
BBa_K2983019 |
Loop B-Alpha | GGTCTCATACTAATGTGAAGAGC | ![]() |
BBa_K2983020 |
Loop Omega-C | GCTCTTCAGGTAAATGTGAGACC | ![]() |
BBa_K2983021 |
Loop C-Alpha | GGTCTCAAATGAATGTGAAGAGC | ![]() |
BBa_K2983022 |
Loop Omega-E | GCTCTTCAGGTAGCTTTGAGACC | ![]() |
BBa_K2983023 |
Loop E-Alpha | GGTCTCAGCTTAATGTGAAGAGC | ![]() |
BBa_K2983024 |
Loop Omega-F | GCTCTTCAGGTACGCTTGAGACC | ![]() |
BBa_K2983025 |
By an ingenious combination of the two Loop sites, Pollak et al. [8] developed a set of vectors that
allow assembly of individual parts: Promoters, 5’UTR, CDS, and Terminators (Level 0
parts) into
Transcriptional units (Level 1 or Odd Level parts) and further on into
Multi-Transcriptional units
(Level 2 or Even Level parts) and even Multi-Multi-Transcriptional units (Level
3 or Odd Level
parts).
Based on the general architecture of our Yarrowia lipolytica Loop assembly platform (Figure 1), we
designed the YL-pOdd (Table 3) and YL-pEven plasmids (Table 4) that allow the same modularity
for the assembly of complex genetic circuits and further are able to integrate into the oleaginous
yeast genome.
Part Name | Loop sites | Part Number |
---|---|---|
YL-pOdd1 | Loop Alpha-A & Loop F-Beta | BBa_K2983030 |
YL-pOdd2 | Loop Beta-A & Loop F-Gamma | BBa_K2983031 |
YL-pOdd3 | Loop Gamma-A & Loop F-Epsilon | BBa_K2983032 |
YL-pOdd4 | Loop Epsilon-A & Loop F-Omega | BBa_K2983033 |
Part Name | Loop sites | Part Number |
---|---|---|
YL-pEven1 | Loop A-Alpha & Loop Omega-B | BBa_K2983036 |
YL-pEven2 | Loop B-Alpha & Loop Omega-C | BBa_K2983037 |
YL-pEven3 | Loop C-Alpha & Loop Omega-E | BBa_K2983038 |
YL-pEven4 | Loop E-Alpha & Loop Omega-F | BBa_K2983039 |
In addition, we expand the initial panel of combinations of two Loop sites described by Pollak et al. [8] to allow assembly into Multi-Transcriptional units composed of not just 4 (as done in [8]) but also of 2 or 3 genes at the Even Level (Table 4).
Part Name | Loop sites | Part Number |
---|---|---|
YL-pOdd5 | Loop Beta-A & Loop F-Omega | BBa_K2983034 |
YL-pOdd6 | Loop Gamma-A & Loop F-Omega | BBa_K2983035 |
The Loop assembly technique
The empty YL-pOdd backbones (Table 2) allow the insertion of one combination of a Promoter, a 5’UTR, a CDS and a Terminator in order to form a Transcriptional unit (Level 1 / Odd level). The assembly is made by Golden Gate using BsaI as restriction enzyme, the acceptor YL-pOdd plasmid as backbone, and the 4 different individual parts flanked by BsaI sites with compatible cutting sites from the Level 0 plasmid set as inserts (Figure 3). However, in eukaryotes the Promoter and the 5’UTR are often not clearly differentiated (since the boundary between the Promoter and the 5’UTR is not precise). Therefore, in this case, the Level 1 assembly is performed with only 3 fragments. The choice of YL-pOdd backbone to be used is dictated by the position of the gene in the multi-transcriptional unit at Level 2 (Even level):
-
pOdd1: for the assembly of Transcriptional units that will be in Position 1 at the Even Level
-
pOdd2: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 3 or 4 genes
-
pOdd3: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 4 genes
-
pOdd4: for the assembly of Transcriptional units that will be in Position 4 at the Even Level Multi-Transcriptional units composed of 4 genes
-
pOdd5: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 2 genes
-
pOdd6: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 3 genes
![](https://static.igem.org/mediawiki/2019/a/ae/T--Evry_Paris-Saclay--Figure3-pOdd1.png)
![](https://static.igem.org/mediawiki/2019/0/0b/T--Evry_Paris-Saclay--Figure3-pOdd2.png)
The Level 1 Transcriptional units can be assembled into Multi-Transcriptional units (Level 2 or Even Level parts) by Golden Gate using SapI as restriction enzyme (Figure 4). The choice of YL-pOdd backbone to be used is dictated by the number of Level 1 Transcriptional units to be assembled and the position in the Multi-multi-transcriptional unit at Level 3 (Odd level).
![](https://static.igem.org/mediawiki/2019/9/9f/T--Evry_Paris-Saclay--Figure4-pEven1.png)
![](https://static.igem.org/mediawiki/2019/6/67/T--Evry_Paris-Saclay--Figure4-pEven2.png)
![](https://static.igem.org/mediawiki/2019/c/c9/T--Evry_Paris-Saclay--Figure4-pEven3.png)
Conclusions
We have designed a Loop assembly system for the oleaginous yeast Yarrowia lipolytica that makes fast and efficient cloning possible by Golden Gate. It offers modularity for assembling complex genetic circuits and their subsequent transfer and integration into the Yarrowia lipolytica genome.
Using the YL-pOdd1 plasmid, we were able to derive several Level 1 transcriptional units that we characterized in Yarrowia lipolytica (the details are available on dedicated pages of this wiki: Promoters & Fluorescent Proteins & Bioproduction). Moreover, different other Yarrowia lipolytica genome integration sequences and auxotrophic selection markers are known and can be used to further expand this Loop assembly system.
This platform facilitates future cloning of genetic constructs for Yarrowia lipolytica and makes it more accessible to the scientific community in general, and the iGEM community in particular.
References
[1]Engler C, Kandzia R, Marillonnet S. A one pot, one step, precision cloning method with high throughput capability. PLoS One (2008) 3, e3647.[2]Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One (2009) 4, e5553.
[3]Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized assembly of multigene constructs. PLoS One (2011) 6, e16765.
[4]Sarrion-Perdigones A, Vazquez-Vilar M, Palacı J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiology (2013) 162, 1618–1631.
[5]Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. EcoFlex: a multifunctional MoClo kit for E. coli synthetic biology. ACS Synth Biol (2016) 5, 1059-1069.
[6]Celińska E, Ledesma-Amaro R, Larroude M, Rossignol T, Pauthenier C, Nicaud JM. Golden Gate Assembly system dedicated to complex pathway manipulation in Yarrowia lipolytica. Microb Biotechnol (2017) 10, 450-455.
[7]Larroude M, Park YK, Soudier P, Kubiak M, Nicaud JM, Rossignol T. A modular Golden Gate toolkit for Yarrowia lipolytica synthetic biology. Microb Biotechnol (2019) 12, 1249-1259.
[8]Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.
[9]Pignède G, Wang HJ, Fudalej F, Seman M, Gaillardin C, Nicaud JM. Autocloning and amplification of LIP2 in Yarrowia lipolytica. Appl Environ Microbiol (2000) 66, 3283-3289.
[10]Barth G, Gaillardin C. Yarrowia lipolytica. In: Wolf K (ed) Non conventional yeasts in biotechnology. Springer, Berlin (1996) 1, 314-388.
[11]Lazar Z, Rossignol T, Verbeke J, Crutz-Le Coq AM, Nicaud JM, Robak M. Optimized invertase expression and secretion cassette for improving Yarrowia lipolytica growth on sucrose for industrial applications. J Ind Microbiol Biotechnol (2013) 40, 1273-1283.
[12]Bordes F, Fudalej F, Dossat V, Nicaud JM, Marty A. A new recombinant protein expression system for high-throughput screening in the yeast Yarrowia lipolytica. J Microbiol Methods (2007) 70, 493-502.
[13]Fickers P, Le Dall MT, Gaillardin C, Thonart P, Nicaud JM. New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. J Microbiol Methods (2003) 55, 727-737.
[14]Xuan JW, Fournier P, Declerck N, Chasles M, Gaillardin C. Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica. Mol Cell Biol (1990) 10, 4795-4806.