Overview

Golden Gate [1, 2] is a powerful molecular biology technique that allows scarless assembly of a large number of DNA fragments. It makes use of type IIS restriction enzymes, such as BsaI, BsmBI, BbsI, SapI, etc., that have the peculiarity of having a recognition site outside their cutting site. This property gives several advantages during cloning:

• It allows scarless assembly: the cutting sites can be designed so that upon digestion and ligation, the final construct has only the desired sequence without the recognition sites.

• It allows assembly of a large number of fragments in a defined order: the cutting sites can be diverse and generate several overhangs after digestion that can be ligated easily and specifically, based on complementarity.

• It allows one pot digestion and ligation: the ligation is irreversible and the final DNA molecule will persist because there is no possibility of recreating the restriction sites. Thus, during the reaction, the final construct continues to accumulate, which increases the overall cloning efficiency.

Golden Gate cloning allows great freedom in design and can employed for building custom made DNA molecules. For these reasons it was adopted by the scientific community who recognised its potential even for developing standardized and modular cloning. Thus, several Golden Gate based tool kits were constructed both for prokaryotes and eukaryotes [3-7 for example]. The recently published Loop assembly system [8] brings Golden Gate cloning to a higher level of creativity and modularity as it allows recursive assembly of DNA fragments.

We welcome the iGEM initiative to fully support Type IIS parts that adhere to the MoClo/ PhytoBricks and Loop Type IIS assembly standards for the first time in the 2019 Competition http://parts.igem.org/Help:Standards/Assembly/Type_IIS.
In this framework, we designed a Loop assembly system dedicated to our chassis, the oleaginous yeast Yarrowia lipolytica.

A Type IIS RFC[10] Loop assembly system for Yarrowia lipolytica

The general architecture of the Yarrowia lipolytica Loop assembly platform is depicted in Figure 1. It is BioBrick RFC[10]-compatible (no illegal EcoRI, XbaI, SpeI, PstI, or NotI site) and has the following features:

• Two Zeta sequences, Zeta Up (BBa_K2983000) and Zeta Down (BBa_K2983001), are flanking the platform. Zeta sequences [9] allow random integrations in Yarrowia lipolytica Po1d strain JMY195 [10] or at a zeta docking platform in Po1d derivative strains like JMY2033 [11] which has the zeta platform at the ura3-302 locus or JMY1212 [12] which has the zeta platform at the leu2-270 locus.

• The URA3 auxotrophic selection marker [13] (BBa_K2983005) which is composed of the URA3 promoter (BBa_K2983002), URA3 gene (BBa_K2983003) and the URA3 terminator (BBa_K2983004). The URA3 gene encodes the orotidine 5'-phosphate decarboxylase, an enzyme (EC. 4.1.1.23) that catalyzes the decarboxylation of orotidine monophosphate to uridine monophosphate in the pyrimidine ribonucleotide synthesis pathway. In the absence of this enzyme, the cells are able to grow only if uracil or uridine is supplemented in the media. The Yarrowia lipolytica Loop assembly platform having this auxotrophic selection marker needs to be used in Δura strains.

• Two traditional cloning sites (BamHI and HindIII) are flanking the URA3 auxotrophic selection marker to allow, if needed, changing it to other selection markers like LEU2 [13], LYS5 [14] or HygR [13].

• The Loop Type IIS cloning sites (triangles in Figure 1, see below for detailed information) and two SfiI sites in between to allow, if needed, the insertion of E. coli cloning selection markers like LacZalpha (BBa_K2448003) or reporter RFP (BBa_J04450) expression cassettes.

The Loop Type IIS cloning sites (triangles above) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1, see Figure 2 for more details). A total of 50 combinations are theoretically possible and some relevant examples are listed in Table 1.

Part name	Sequence with BsaI and SapI sites highlighted		Part number
Loop Alpha-A	GCTCTTCAATGAGGAGTGAGACC		BBa_K2983010
Loop F-Beta	GGTCTCACGCTAGCATGAAGAGC		BBa_K2983011
Loop Beta-A	GCTCTTCAGCAAGGAGTGAGACC		BBa_K2983012
Loop F-Gamma	GGTCTCACGCTATACTGAAGAGC		BBa_K2983013
Loop Gamma-A	GCTCTTCATACAGGAGTGAGACC		BBa_K2983014
Loop F-Epsilon	GGTCTCACGCTACAGTGAAGAGC		BBa_K2983015
Loop Epsilon-A	GCTCTTCACAGAGGAGTGAGACC		BBa_K2983016
Loop F-Omega	GGTCTCACGCTAGGTTGAAGAGC		BBa_K2983017
Loop A-alpha	GGTCTCAGGAGAATGTGAAGAGC		BBa_K2983018
Loop Omega-B	GCTCTTCAGGTATACTTGAGACC		BBa_K2983019
Loop B-Alpha	GGTCTCATACTAATGTGAAGAGC		BBa_K2983020
Loop Omega-C	GCTCTTCAGGTAAATGTGAGACC		BBa_K2983021
Loop C-Alpha	GGTCTCAAATGAATGTGAAGAGC		BBa_K2983022
Loop Omega-E	GCTCTTCAGGTAGCTTTGAGACC		BBa_K2983023
Loop E-Alpha	GGTCTCAGCTTAATGTGAAGAGC		BBa_K2983024
Loop Omega-F	GCTCTTCAGGTACGCTTGAGACC		BBa_K2983025

By an ingenious combination of the two Loop sites, Pollak et al. [8] developed a set of vectors that allow assembly of individual parts: Promoters, 5’UTR, CDS, and Terminators (Level 0 parts) into Transcriptional units (Level 1 or Odd Level parts) and further on into Multi-Transcriptional units (Level 2 or Even Level parts) and even Multi-Multi-Transcriptional units (Level 3 or Odd Level parts).

Based on the general architecture of our Yarrowia lipolytica Loop assembly platform (Figure 1), we designed the YL-pOdd (Table 3) and YL-pEven plasmids (Table 4) that allow the same modularity for the assembly of complex genetic circuits and further are able to integrate into the oleaginous yeast genome.

Part Name	Loop sites	Part Number
YL-pOdd1	Loop Alpha-A & Loop F-Beta	BBa_K2983030
YL-pOdd2	Loop Beta-A & Loop F-Gamma	BBa_K2983031
YL-pOdd3	Loop Gamma-A & Loop F-Epsilon	BBa_K2983032
YL-pOdd4	Loop Epsilon-A & Loop F-Omega	BBa_K2983033

Part Name	Loop sites	Part Number
YL-pEven1	Loop A-Alpha & Loop Omega-B	BBa_K2983036
YL-pEven2	Loop B-Alpha & Loop Omega-C	BBa_K2983037
YL-pEven3	Loop C-Alpha & Loop Omega-E	BBa_K2983038
YL-pEven4	Loop E-Alpha & Loop Omega-F	BBa_K2983039

In addition, we expand the initial panel of combinations of two Loop sites described by Pollak et al. [8] to allow assembly into Multi-Transcriptional units composed of not just 4 (as done in [8]) but also of 2 or 3 genes at the Even Level (Table 4).

Part Name	Loop sites	Part Number
YL-pOdd5	Loop Beta-A & Loop F-Omega	BBa_K2983034
YL-pOdd6	Loop Gamma-A & Loop F-Omega	BBa_K2983035

The Loop assembly technique

The empty YL-pOdd backbones (Table 2) allow the insertion of one combination of a Promoter, a 5’UTR, a CDS and a Terminator in order to form a Transcriptional unit (Level 1 / Odd level). The assembly is made by Golden Gate using BsaI as restriction enzyme, the acceptor YL-pOdd plasmid as backbone, and the 4 different individual parts flanked by BsaI sites with compatible cutting sites from the Level 0 plasmid set as inserts (Figure 3). However, in eukaryotes the Promoter and the 5’UTR are often not clearly differentiated (since the boundary between the Promoter and the 5’UTR is not precise). Therefore, in this case, the Level 1 assembly is performed with only 3 fragments. The choice of YL-pOdd backbone to be used is dictated by the position of the gene in the multi-transcriptional unit at Level 2 (Even level):

• pOdd1: for the assembly of Transcriptional units that will be in Position 1 at the Even Level

• pOdd2: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 3 or 4 genes

• pOdd3: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 4 genes

• pOdd4: for the assembly of Transcriptional units that will be in Position 4 at the Even Level Multi-Transcriptional units composed of 4 genes

• pOdd5: for the assembly of Transcriptional units that will be in Position 2 at the Even Level Multi-Transcriptional units composed of 2 genes

• pOdd6: for the assembly of Transcriptional units that will be in Position 3 at the Even Level Multi-Transcriptional units composed of 3 genes

The Level 1 Transcriptional units can be assembled into Multi-Transcriptional units (Level 2 or Even Level parts) by Golden Gate using SapI as restriction enzyme (Figure 4). The choice of YL-pOdd backbone to be used is dictated by the number of Level 1 Transcriptional units to be assembled and the position in the Multi-multi-transcriptional unit at Level 3 (Odd level).

Conclusions

We have designed a Loop assembly system for the oleaginous yeast Yarrowia lipolytica that makes fast and efficient cloning possible by Golden Gate. It offers modularity for assembling complex genetic circuits and their subsequent transfer and integration into the Yarrowia lipolytica genome.

Using the YL-pOdd1 plasmid, we were able to derive several Level 1 transcriptional units that we characterized in Yarrowia lipolytica (the details are available on dedicated pages of this wiki: Promoters & Fluorescent Proteins & Bioproduction). Moreover, different other Yarrowia lipolytica genome integration sequences and auxotrophic selection markers are known and can be used to further expand this Loop assembly system.

This platform facilitates future cloning of genetic constructs for Yarrowia lipolytica and makes it more accessible to the scientific community in general, and the iGEM community in particular.

References

[1]Engler C, Kandzia R, Marillonnet S. A one pot, one step, precision cloning method with high throughput capability. PLoS One (2008) 3, e3647.
[2]Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One (2009) 4, e5553.
[3]Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized assembly of multigene constructs. PLoS One (2011) 6, e16765.
[4]Sarrion-Perdigones A, Vazquez-Vilar M, Palacı J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiology (2013) 162, 1618–1631.
[5]Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. EcoFlex: a multifunctional MoClo kit for E. coli synthetic biology. ACS Synth Biol (2016) 5, 1059-1069.
[6]Celińska E, Ledesma-Amaro R, Larroude M, Rossignol T, Pauthenier C, Nicaud JM. Golden Gate Assembly system dedicated to complex pathway manipulation in Yarrowia lipolytica. Microb Biotechnol (2017) 10, 450-455.
[7]Larroude M, Park YK, Soudier P, Kubiak M, Nicaud JM, Rossignol T. A modular Golden Gate toolkit for Yarrowia lipolytica synthetic biology. Microb Biotechnol (2019) 12, 1249-1259.
[8]Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.
[9]Pignède G, Wang HJ, Fudalej F, Seman M, Gaillardin C, Nicaud JM. Autocloning and amplification of LIP2 in Yarrowia lipolytica. Appl Environ Microbiol (2000) 66, 3283-3289.
[10]Barth G, Gaillardin C. Yarrowia lipolytica. In: Wolf K (ed) Non conventional yeasts in biotechnology. Springer, Berlin (1996) 1, 314-388.
[11]Lazar Z, Rossignol T, Verbeke J, Crutz-Le Coq AM, Nicaud JM, Robak M. Optimized invertase expression and secretion cassette for improving Yarrowia lipolytica growth on sucrose for industrial applications. J Ind Microbiol Biotechnol (2013) 40, 1273-1283.
[12]Bordes F, Fudalej F, Dossat V, Nicaud JM, Marty A. A new recombinant protein expression system for high-throughput screening in the yeast Yarrowia lipolytica. J Microbiol Methods (2007) 70, 493-502.
[13]Fickers P, Le Dall MT, Gaillardin C, Thonart P, Nicaud JM. New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. J Microbiol Methods (2003) 55, 727-737.
[14]Xuan JW, Fournier P, Declerck N, Chasles M, Gaillardin C. Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica. Mol Cell Biol (1990) 10, 4795-4806.