Team:XHD-WS-Wuhan-A/experiment/protocol/
Protocol
Recombinant plasmid construction
1. primer design
2. Obtain the target gene fragment
a. Run PCR
|
experimental material |
|
|
template gene |
1ul |
|
sense Primer |
0.5ul |
|
antisense primer |
0.5ul |
|
dNTP |
1ul |
|
enzyme |
1ul |
|
2*buffer solution |
25ul |
|
Water |
21ul |
Put the mixture into the PCR instrument, run related program
3. Obtain the enzyme cutting vector
a. Enzyme digestion
I. Raw materials: Sall enzyme, NotI enzyme , water, buffer, plasmid
II. inject enzyme, buffer and water into the tube containing plasmids.
III. The tube was put into a 37 ° C water bath and digested for 4 hours.
IV. Remove the tube from the water bath, recycle the gel and put it at 4℃.
b. Agar Gel electrophoresis
c. Gel recycling
4. Ligation
Meterial: recombinase, the enzyme cutting vector, the target gene fragment and H2O
I. Add DNA fragments and cleaved plasmid as 4:1 into test tube.
II. Add recombinase and water. Place it into the 37 ° C water bath for 30 min.
5. Transformation (shake bacteria, coated plate, pick bacteria, elution)
a. Making a medium
I. Mix 1 gram of Tryptone, 1 gram of NaCl, 0.5 g of yeast and add water to 100 ml.
II. Mix the solution with a magnetic stirrer.
III. Distribute the stirred solution into different test tubes and sterilize them with autoclave for 30 min
IV. Remove the solution, store some under 4 ° C and add others with agarose powder and store at 4 ° C after it solidify
b. Transformation
I. Take the medium from 4 ° C
II. Add the plasmid into the competent cell. Ice for 30 min, heat for 45 seconds and - Ice again for 5 min or more
III. Place the test tube on a shaker at 37 ° C and 150 rpm for 1 hour
IV. Take the competent bacteria from the shaker
V. Swab the competent bacteria on the medium
VI. Immerse sticks into alcohol twice
VII. After the stick cooled down, use it to spread the bacteria by drawing ‘z’ shape on the medium.
VIII. After that, seal the medium, mark the corresponding date and bacteria, culture the medium in the incubator overnight at 37 ° C (up to 12 hours).
C. Pick the bacteria
I. Remove the cultured dish from incubator
II. Use the tip of the gun to spot the bacteria to remove the bacteria
III. Throw the tip that has the bacteria into liquid medium and put it into the shake at 150 rpm overnight.
IV. Extract the cultured bacteria from the cultured medium
d. obtain the plasmid
I. Add 500 μl of equilibration solution BL to the adsorption column CP3, centrifuge for 1 minute at 12000 rpm, discard the waste from the collection tube, and return the adsorption column to the collection tube.
II. Take 1-5 ml of bacterial solution, add to the centrifuge tube, centrifuge 1 minute at 12000 rpm, try to remove the supernatant.
III. Add 250 μl of solution P1 to the centrifuge tube where the bacteria are left to precipitate, use the gun to stir until no precipitate can be observed by naked eye
IV. Add 250 μl of P2 to the centrifuge tube, gently flip the tube 6-8 times. So that the cell lysis.
V. Add 350 μl to the centrifuge tube P3, immediately gently flip the tube up and down 6-8 times until fully mixed, this time there will be white flocculent precipitation.
VI. Transfer the supernatant collected from the previous step to the suction column P3 and place it in the collection tube (do not draw the precipitate).
VII. Use 12000rpm to centrifuge 30-60 seconds, drained the waste in the collection tube, place the adsorption column into the collection tube.
VIII. Add 600 μl of rinse PW solution to the adsorption column, centrifuge at 12,000 rpm for 30-60 seconds, discard the waste in the collection tube, and place the column into the collection tube.
IX. Repeat step 7
X. Centrifuge adsorption column CP3 again at 12,000 rpm for 2 minutes, drained the waste.
XI. Place the adsorption column in a clean centrifuge tube, add 50-100 μl of the elution buffer to the middle of the adsorbent membrane, allow the mixture to stand for 2 minutes at room temperature, centrifuge at 12000 rpm for 2 minutes and collect the plasmid solution into the centrifuge tube.
e. Ligation
Material: recombinase, the enzyme cutting vector, the target gene fragment and H2O
I. Add DNA fragments and cleaved plasmid as 4:1 into test tube.
II. Add recombinase and water. Place it into the 37 ° C water bath for 30 min.
f. Sequencing
II. Send the plasmid for sequencing after observing the line.
cell culture
1. Culture Conditions
I. Atmosphere: CO2, 5%；
II. Temperature: 37 °C.
2. Complete Growth Medium
I. To make the complete growth medium, add the following components to the base medium: fetal bovine serum to a final concentration of 10%.
3. Transfection
I. Cells should be plated 18 to 24 hours prior to transfection so that the monolayer cell density reaches to the optimal 60~70% confluency at the time of transfection.
II. For plasmid DNA transfection experiment, we recommend using 500ng DNA per well in a 24-well plate.
III. Add 500ng of plasmid DNA to the 25ul transfection medium opti, and mix immediately. Incubate the transfection mixture for 5 minutes at room temperature.
IV. Add 1ul of transfection reagent to the 25ul transfection medium opti, and mix immediately. Incubate the transfection mixture for 5 minutes at room temperature.
V. Allow the transfection Reagent/DNA complex to incubate at room temperature for 15 minutes to let transfection complex form. Never keep the complex longer than 30 minutes.
VI. Add the transfection complex to the cells drop wise.
VII. Replace fresh medium after 4~6 hours and continue to culture for 24~48 hours.
quantitative real time PCR
a. Primer design
IL7-AS-S2-F: 5' CCATCCATTGTCATGTTTTCTG 3'
IL7-AS-S2-R: 5' TTTTTTTGGGGTAGTTTGCTATAT 3'
GAPDH-F: 5' TGCACCACCAACTGCTTAGC 3'
GAPDH-R: 5' GGCATGGACTGTGGTCATGAG 3'
b. RNA extraction
I. The 24 hole plate was added with 500ul Trizol per hole and sucked into EP tube.
II. 120ul chloroform was added to the operating table. After severe shaking, it was left for 3min and centrifuged for 18000g 15min
III. The supernatant was absorbed in another tube, and the same amount of isopropanol was added.
IV. severe shaking and left it for 10min and centrifuged for another 18000g for 10min
V. Discard the supernatant and add 600ul 75% alcohol per tube
VI. severe shaking and 18000g centrifugation for 10min
VII. Repeat step 3
VIII. Place on the drying machine at room temperature for 10min
IX. Add appropriate amount of water (6.5ul or 12.5ul) to each tube as required and place it in the oven for 10min
c. obtain the cDNA
I. Removal of Genomic DNA
Mix the following components thoroughly in a RNase-free PCR tube and incubate at 42oC for 2 min.
|
RNase free ddH2O |
to8ul |
|
4x gDNA Wiper Mix |
2 ul |
|
Oligo (dT)18(10 uM) |
|
|
or Random Hexamers (50 ng/ul) |
0.5ul |
|
orGene Specific Primers (2 uM) |
|
|
Template RNA |
Total RNA: 1 pg-500 ng |
II. Add 2 µl of 5× HiScript II Select qRT SuperMix II to the mixture of Step 1 (8 µl) and mix thoroughly.
No RT Control (Optional): No RT Control is a negative control which contains no Reverse Transcriptase and is used to indicate whether there is residual
genomic DNA in RNA template. Add 2 µl of 5× Select No RT Control Mix to the mixture of Step 1 (8 µl) and mix thoroughly.
III. Reverse transcription
|
50 oC* |
15min |
|
85 oC |
2min |
Note: * For templates with complex secondary structure or high GC-content, the temperature can be increased to 55℃, which will benefit the yield.
The products can be used for PCR immediately or be stored at -20℃ for 6 months. However, it is recommended to stored at -80℃ and make aliquots to
avoid repeated freezing and thawing.
d. Q-PCR
I. Prepare the reaction solution as follows:
|
2x ChamQ SYBR qPCR Master Mix (High ROX Premixed) |
10ul |
|
Primer1 (10 uM) |
0.4ul |
|
Primer2 (10 uM) |
0.4ul |
|
Template DNA/cDNA |
xul |
|
ddH2O |
To 20.0ul |
Note: For each component, the volume of can be adjusted according to the following principle:
a. The final concentration of primer is usually 0.2 µM, and if necessary, it can be adjusted between 0.1 µM and 1.0 µM.
b. The accuracy of template volumes impacts significantly on the qPCR results, due to the high sensitivity of ChamQ SYBR® qPCR Master Mix. Therefore, to improve
experimental repeatability, it is recommended to dilute the template and pipet 2 µl-5 µl to the reaction system.
c. The size of the amplicon should be within the range of 80 bp-150 bp.
d. The volume of template (i.e. undiluted template) should be ≤ 1/10 of total volume
II. Place the sample in a qPCR instrument and run the following program for qPCRc
|
Stage1 |
Pre-denaturationa |
Reps: 1 |
95 oC |
30sec |
|
Stage2 |
Denaturation |
Reps: 40 |
95 oC |
10sec |
|
Annealing + Extensionb |
60 oC |
30sec |
||
|
Stage3 |
Melting CurvesC |
Reps: 1 |
95 oC |
15sec |
|
60 oC |
60sec |
|||
|
95 oC |
15sec |
a. Pre-denaturation at 95℃ for 30 sec is suitable for most amplification. However, it could be prolonged to 3 min for templates with complicated structures.
b. Extension for 30 sec is suitable for amplicons ≤ 300 bp. It is recommended to prolong extension to 60 sec for amplicons > 300 bp.
c. Program for melting curve may vary qPCR instruments. Please select the default melting curve program of the instrument used.
Address
XHD-WS-Wuhan-A
Wuhan High School
No.538,Gongxiu Road,Xiaoshan District,
Wuhan,Hubei Province,China