Team:Moscow/Lab Journal

Lab Journal

Project evolution

Brainstorming the project theme is a critical stage of research activity in the framework of the iGEM contest. For the Moscow team this stage was long and highly productive. The discussion lasted for three months. As a result, we decided to develop a system to detect Lyme disease agents transmitted by ticks.
Before arriving at the decision to develop a biosensor based on CRISPR/Cas system, our team considered several options:
  • A PLAST-MASS system based on modified Escherichia coli capable of recycling laboratory plastic thereby solving the problem of its disposal;
  • Developing a biosafe kit based on Bacillus subtilis to popularize synthetic biology among schoolchildren;
  • Using bacteriophage endolysins in therapeutics. Bacteriophage endolysins are a viable alternative to antibiotics as they efficiently and specifically lyse cells from the inside without being toxic to the body and causing allergic reactions.
  • We came up with a few approaches to developing biosensors: developing a biosensor based on RNA aptamers and fluorogenic ligands, detecting trichomoniasis and lactophages using the CRISPR / dCas9 system.
After a long-term research and discussion, we turned to the idea of using the CRISPR/dCas9 system as a biosensor; we still had to decide what we were going to detect. Several options were suggested such as pollen and causative agents of borreliosis and encephalitis. We eventually came to the conclusion that detecting Lyme disease agents transmitted by ticks would be the most relevant and technically feasible for us.

Wet Lab

Week 1. 10.06 - 16.06
  • competent cells preparation
    * Bacillus subtilis competent cells preparation according to recommendations from IGEM 2016 team collaboration
    * “Ultra Competent” E.coli Cells preparation Protocol
  • E.coli transformation with PET28a GFP plasmid and BBa_K1150000 (dCas9) Protocol
Week 2. 17.06 - 23.06
Week 3. 24.06 - 30.06
Week 4. 01.07 - 07.07
  • clones checking via PCR with universal primers VF2 & VR
  • Sequencing BBa_K1150000
  • Sequence alignment (sequence is inconsistent)
Week 5. 08.07 - 14.07
  • “to-get-visa” trip
Week 6. 15.07 - 21.07
  • Received bacterial expression plasmid for Sp-dCas9 & sgRNA MSP712
  • MSP712 plasmid DNA extraction according to Kit instructions
  • MSP712 plasmid restriction analysis - did not match with our virtual digest result. A possible explanation is that there was a mistake in plasmid annotation. We decided not to use MSP712 plasmid for our experiments.
Week 7. 22.07 - 28.07
Week 8. 29.07 - 04.09
Week 9. 05.08 - 11.08
  • restriction with EcoRI and SpeI. (according to )
  • PCR analysis with VF2 and VR primers
Week 10. 12.08 - 18.08
  • primer design for reconstituting the fragments into pET vector
  • Received bacterial expression plasmid for Sp-dCas9
Week 9. 11.08 - 17.08
  • restriction with EcoRI and SpeI. (according to )
  • PCR analysis with VF2 and VR primers
Week 10. 18.08 - 25.08
  • primer design for reconstituting the fragments into pET vector
Week 11. 19.08 - 25.08
name length Tm atgc restriction site
dCas_rev 38 56 atatgcggccgctcagtcacctcctagctgactcaaat NotI
dCas_for 45 62 atatgaattccgataagaaatactcaataggcttagctatcggcac EcoRI
N_for 36 60 atatgaattccccagaaacgctggtgaaagtaaaag EcoRI
C_rev 36 56 atatgcggccgcccaatgcttaatcagtgaggcacc NotI
Week 12. 26.08 - 01.09
  • restriction + ligation + transformation in order to change the backbone to pET28 (no good result)
  • Purifying plasmids with various Cas genes
    1. Took the following plasmids received on filter paper from Addgene:
    2. Elution of plasmids from Addgene filter paper following the protocol
    3. Transformed the plasmids to XL10 strain following the protocol:
      • Made the following samples:
        XL10 + pMJ806
        XL10 + pET-CjCas9
        XL10 (as negative control)
      • Plated suspensions on LB+Cm+Kan plates in the following way:
        XL10 + pMJ806 - 1:1 (45ul) and 1:10 (5ul + 45ul LB)
        XL10 + pET-CjCas9 - 1:1 (45ul) and 1:10 (5ul + 45ul LB)
        XL10 (as negative control) - 1:1 (45ul)
Week 13. 02.09 - 09.09
  • working with BBa_K1189007, transformation and clone-check
  • midi-prep of the expressing culture
  • restriction analysis of the part
  • Purifying plasmids with various Cas genes
    1. Took the following plasmids received from A.Greshnova as pellets, collected from 20 ml liquid culture and frozen at -20C:
    Name Working name Source Link Description Strain
    pMJ841 piGEM2019-8 Addgene link T7-6His-MBP-(Sp)dCas9 Homebrew DH5a
    pMJ825 piGEM2019-9 Addgene link T7-6His-MBP-(Sp)nCas9 Homebrew DH5a
    p6XHis_NLS-SaCas9 piGEM2019-10 Addgene link T7-6His-NLS-(Sa)Cas9 Homebrew DH5a
    MSP2262 piGEM2019-11 Addgene link T7-human(Sa)dCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) Homebrew DH5a
    pBLO 64.1 piGEM2019-15 Addgene link Deltaproteobacteria CasX Homebrew DH5a
    pBLO 62.4 piGEM2019-16 Addgene link Deltaproteobacteria CasX-sgRNA Homebrew DH5a
    1. Performed purification following protocol Bacteria Plasmid prep (QIAGEN - Gluhovg modified):
      Comments: a. Added RNase at step 5 b. Did not perform filtering at step 10 c. Performed step 12 in 1.5ml tubes, thus repeatedly added sample to the same tubes and spinned d. Did not perform additional purification from RNA
    2. Applied 5ul of each sample for gel electrophoresis (0.5% agarose, TAE, 15’, 1kb Ladder)
      Results: bands visible for piGEM8-9 and 11-15
    3. Measured nucleic acids conc by NanoDrop2000
    Results:
Sample ID Date and Time Conc, ng/ul A260 (Abs) A280 (Abs) 260/280 260/230 Sample Type Factor
Blank 21.09.2019 12:58:32 -0,1 -3 -11 0,24 -0,59 DNA 50,00
iGEM2019-8 21.09.2019 13:03:04 475,5 9,509 4,939 1,93 2,26 DNA 50,00
iGEM2019-9 21.09.2019 13:04:04 1411,1 28,222 14,380 1,96 2,46 DNA 50,00
iGEM2019-10 21.09.2019 13:05:10 2323,5 46,470 23,979 1,94 2,39 DNA 50,00
iGEM2019-11 21.09.2019 13:06:08 2204,8 44,095 22,759 1,94 2,28 DNA 50,00
iGEM2019-15 21.09.2019 13:00:20 4203,4 84,068 43,095 1,95 2,57 DNA 50,00
iGEM2019-16 21.09.2019 13:01:56 5262,9 105,257 54,632 1,93 2,52 DNA 50,00
 
  • Design of spacer cloning to sgRNA expression cassette
    1. Materials:
      1. Tagrets: combo_cas9 - contain spacer complementary regions and PAM-sites for different pairs of dCas9 variants separated with 21 bp fragment
      2. Vectors:
        • MSP712 and BPK764 - contain expression cassettes PT7-BsaI-gRNAscaffold-T7terminator, suitable for SpCas9 sgRNA
        • BPK2101 - contain expression cassettes PT7-BsaI-gRNAscaffold-T7terminator, suitable for SaCas9 sgRNA
        • BBa_K1689000 - sgRNA generator, PT7-BsaI-lacZ-PlacZ-BsaI-gRNAscaffold-T7terminator, suitable for type II CRISPR systems
    2. Designed oligos for gRNA sequence insert
      1. For all “top” strands added GG to 5’ end - that enhance sgRNA expression from the T7 promoter
        Correspondingly added CC to 3’-end of “bottom” strand to make full complementarity
      2. Added sticky ends to 5’-end of both oligos to enable ligation with BsaI-treated vector
        Sticky ends depended on vector sequence and thus were different for each plasmid
    3. Performed in silico cloning of oligos to the corresponding vectors by BsaI restriction and ligation:
Target Stand Oligo name Compatible to Vector Cloning product
Sp_target_1 top Sp_target_1 gRNA oligo-top MSP712 MSP712 + Sp_target_1 sgRNA
bottom Sp_target_1 gRNA oligo-bottom
Sp_target_2 top Sp_target_2 gRNA oligo-top MSP712 + Sp_target_2 sgRNA
bottom Sp_target_2 gRNA oligo-bottom
Sp_target_1_2 top Sp_target_1_2 gRNA oligo-top MSP712 + Sp_target_1_2 sgRNA
bottom Sp_target_1_2 gRNA oligo-bottom
Sp_target_1_3 top Sp_target_1_3 gRNA oligo-top MSP712 + Sp_target_1_3 sgRNA
bottom Sp_target_1_3 gRNA oligo-bottom
Sp_target_1 top Sp_target_1 gRNA oligo-top BPK764 BPK764 + Sp_target_1 sgRNA
bottom Sp_target_1 gRNA oligo-bottom #2
Sp_target_2 top Sp_target_2 gRNA oligo-top BPK764 + Sp_target_2 sgRNA
bottom Sp_target_2 gRNA oligo-bottom #2
Sp_target_1_2 top Sp_target_1_2 gRNA oligo-top BPK764 + Sp_target_1_2 sgRNA
bottom Sp_target_1_2 gRNA oligo-bottom #2
Sp_target_1_3 top Sp_target_1_3 gRNA oligo-top BPK764 + Sp_target_1_3 sgRNA
bottom Sp_target_1_3 gRNA oligo-bottom #2
Sa_target_2 top Sa_target_2 gRNA oligo-top BPK2101 BPK2101 + Sa_target_2 sgRNA
bottom Sa_target_2 gRNA oligo-bottom
Sp_target_1 top Sp_target_1 gRNA oligo-top #2 BBa_K1689000 BBa_K1689000 + Sp_target_1 sgRNA
bottom Sp_target_1 gRNA oligo-bottom
Sp_target_2 top Sp_target_2 gRNA oligo-top #2 BBa_K1689000 + Sp_target_2 sgRNA
bottom Sp_target_2 gRNA oligo-bottom
Sp_target_1_2 top Sp_target_1_2 gRNA oligo-top #2 BBa_K1689000 + Sp_target_1_2 sgRNA
bottom Sp_target_1_2 gRNA oligo-bottom
Sp_target_1_3 top Sp_target_1_3 gRNA oligo-top #2 BBa_K1689000 + Sp_target_1_3 sgRNA
bottom Sp_target_1_3 gRNA oligo-bottom
Sa_target_2 top Sa_target_2 gRNA oligo-top #2 BBa_K1689000 + Sa_target_2 sgRNA
bottom Sa_target_2 gRNA oligo-bottom
Week 14. 10.09 - 17.09
Week 15. 18.09 - 25.09
Week 16. 26.09 - 01.10
  • PCR optimization and clean-up
  • beta-lactamase tests planning
Week 17. 02.10 - 09.10
  • 3A assembly with BBa_K1689014, BBa_K1689013, BBa_B0015, BBa_B0017(in pairs in parallel) to get BBa_K3028001 & BBa_K3028002
  • Biobrick characterization
  • Getting BBa_K1689000 part
    1. Recovered BBa_K1689000 BioBrick on pSB1C3 plasmid from iGEM2019 kit following the protocol:
      Info on iGEM Registry page
      Biobrick sequence in Benchling
    2. Transformed the part to DH5a strain following the protocol: a. Made the following samples:
      DH5a + BBa_K1689000
      DH5a (as negative control) b. Plated suspensions on LB+Cm plates:
      DH5a + BBa_K1689000 - 1:1 (45ul)
      DH5a + BBa_K1689000 1:10 (5ul + 45ul LB)
      DH5a (as negative control) - 1:1 (45ul)
    3. Collected the plates from previous day and made photos on ChemiDoc XRS+ System
      4. DH5a + BBa_K1689000 - 1:1 (45ul)
      DH5a + BBa_K1689000 - 1:1 (45ul)
      DH5a + BBa_K1689000 1:10 (5ul + 45ul LB)
      DH5a + BBa_K1689000 1:10 (5ul + 45ul LB)
      DH5a (as negative control) - 1:1 (45ul)
      DH5a (as negative control) - 1:1 (45ul)
    4. Picked 3 colonies from 1:1 plate and re-streaked them on LB+Cm (25ug/ml) plate
    5. Incubated at 37C ON
    6. Collected the plates from previous day and made photos on ChemiDoc XRS+ System
      7. DH5a + BBa_K1689000 cl.1-3
    7. Put 3 colonies to a 15ml falcon tubes each with 6ml LB+Cm (25ug/ml)
    8. Incubated at 37C and 220rpm ON
    9. Aliquoted 250ul of ON culture to two 1.5ml tubes for each clone. Stored at +4C
    10. Used the rest of the culture to extract plasmids following the Bacteria Plasmid prep (Evrogen - Zaytsev P. modified) protocol:
      Didn’t use optional step 10
Week 18. 10.10 - 17.10
• judging form deadline
• sequence results analysis
• Getting pSB1K3 part
  1. Recovered pSB1K3 plasmid from iGEM2019 kit following the protocol:
    Info on iGEM Registry page
    Biobrick sequence in Benchling
  2. Transformed the part to DH5a strain following the protocol:
    a. Made the following samples:
    DH5a + pSB1K3
    DH5a (as negative control)
    b. Plated suspensions on LB+Kan plates:
    DH5a + pSB1K3 - 1:1 (45ul)
    DH5a + pSB1K3 1:10 (5ul + 45ul LB)
    DH5a (as negative control) - 1:1 (45ul)
  3. Collected the plates from previous day and made photos on ChemiDoc XRS+ System
    4. DH5a + pSB1K3
    DH5a + pSB1K3
    DH5a
    DH5a
  4. Re-streaked 3 colonies on LB+Kan (50ug/ml)
  5. Incubated at 37C ON
  6. Collected the plates from previous day and made photos on ChemiDoc XRS+ System
    7. DH5a + pSB1K3+RFP cl.1-3
    DH5a + pSB1K3+RFP cl.1-3
  7. Put 3 colonies to a 15ml falcon tube each with 6ml LB+Kan (50ug/ml)
  8. Incubated at 37C and 220rpm ON
  9. Collected the tubes with pSB1K3 part from previous day and stored them at +4C
  10. Aliquoted 250ul of ON culture (from 10.10.2019) to two 1.5ml tubes for each clone. Stored at +4C
  11. Used the rest of the culture to extract plasmids following the Bacteria Plasmid prep (Evrogen - Zaytsev P. modified) protocol:
    Didn’t use optional step 10
  12. Measured the concentration of extracted plasmids by NanoDrop2000:
Sample ID Date and Time Conc, ng/ul A260 (Abs) A280 (Abs) 260/280 260/230 Sample Type Factor
Blank 11.10.2019 18:17:02 0.1 1.0 -0.9 2 4 DNA 5000
pSB1K3+RFP cl.1 11.10.2019 18:22:53 112.4 22.49 11.94 1.88 1.75 DNA 5000
pSB1K3+RFP cl.2 11.10.2019 18:23:36 93.7 18.73 9.67 1.94 1.76 DNA 5000
pSB1K3+RFP cl.3 11.10.2019 18:24:23 113.3 22.67 11.88 1.91 1.62 DNA 5000
  1. Estimated concentration and checked samples by gel electrophoresis:
0.5% agarose, 1xTAE, 110V, 30min
1ul of Ladder/sample + 1ul 6xLoadDye + 4ul MilliQ
Getting BBa_K1689000 part
  1. Measured the concentration of extracted plasmids (from 06.10.2019) by NanoDrop2000:
Sample ID Date and Time Conc, ng/ul A260 (Abs) A280 (Abs) 260/280 260/230 Sample Type Factor
Blank 10.10.2019 19:07:02 4 9 1 0.853 0.45 DNA 5000
pSB1C3 + sgRNA-gen cl.1 10.10.2019 19:08:10 173.6 34.71 18.86 1.84 1.75 DNA 5000
pSB1C3 + sgRNA-gen cl.2 10.10.2019 19:08:56 166.2 33.24 17.85 1.86 1.92 DNA 5000
pSB1C3 + sgRNA-gen cl.3 10.10.2019 19:09:38 220.0 44.0 23.18 1.90 2.00 DNA 5000
  1. Estimated concentration and checked samples by gel electrophoresis:
    2. 0.5% agarose, 1xTAE, 110V, 30min
    1ul of Ladder/sample + 1ul 6xLoadDye + 4ul MilliQ
Cloning of sgRNA to BBa_K1689000 part Followed the Adapted protocol from Zhang Lab:
  1. Used the following vectors and oligos for cloning:
Target Stand Oligo name Compatible to Vector Cloning product
Sp_target_1 top Sp_target_1 gRNA oligo-top #2 BBa_K1689000 BBa_K1689000 + Sp_target_1 sgRNA
bottom Sp_target_1 gRNA oligo-bottom
Sp_target_2 top Sp_target_2 gRNA oligo-top #2 BBa_K1689000 + Sp_target_2 sgRNA
bottom Sp_target_2 gRNA oligo-bottom
Sp_target_1_2 top Sp_target_1_2 gRNA oligo-top #2 BBa_K1689000 + Sp_target_1_2 sgRNA
bottom Sp_target_1_2 gRNA oligo-bottom
Sp_target_1_3 top Sp_target_1_3 gRNA oligo-top #2 BBa_K1689000 + Sp_target_1_3 sgRNA
bottom Sp_target_1_3 gRNA oligo-bottom
Sa_target_2 top Sa_target_2 gRNA oligo-top #2 BBa_K1689000 + Sa_target_2 sgRNA
bottom Sa_target_2 gRNA oligo-bottom
  1. Performed steps 1-2
    a. Took all three plasmids with BBa_K1689000 part extracted previously
    b. Calculated concentration of all plasmids as if they were 0.2ug/ul
  2. Performed steps 3-5
    3. Check electrophoresis
    Check electrophoresis 1ul sample applied 1.5% agarose, 30min, 110V, 1xTAE
    Electrophoresis for fragment extraction
    Electrophoresis for fragment extraction Combined 20ul of each sample in one and applied all 1.5% agarose, 45min, 110V, 1xTAE
  3. Performed step 6
    a. Cut from the gel the band of two-cuts plasmid w/o lacZ insert.
    b. Gel purified it using QIAquick Gel Extraction Kit and eluted in MilliQ. Measured concentration by NanoDrop2000:
Sample ID Date and Time Conc, ng/ul A260 (Abs) A280 (Abs) 260/280 260/230 Sample Type Factor
Blank 11.10.2019 18:17:02 0.1 1.0 -0.9 2 4 DNA 5000
pSB1C3+sgRNA-gen BsaI 11.10.2019 18:35:25 11.6 23.2 10.9 21.3 0.5 DNA 5000
c. Performed steps 7-12
• Cloning of sgRNA to BBa_K1689000 part
Followed the Adapted protocol from Zhang Lab Performed step 14 - transformation of samples to DH5a strain following the protocol
Week 19. 18.10 - 25.10
  • wiki freeze deadline

Dry Lab

Week 1. 10.06 - 16.06
  • PAM sequences of Cas9 proteins were found for three organisms: Streptococcus pyogenes, Staphylococcus aureus, Campylobacter jejuni
  • A list of tick-borne diseases was made
  • Analysis of the most dangerous species (in Russia) from Ixodes family
  • A list of organisms (pathogenic and nonpathogenic) associated with Ixodes ricinus was made
  • The model of two SpCas9 proteins in Chimera was made to determine the number of bases between two dCas9 proteins (PAM-in orientation)
Week 2. 17.06 - 23.06
The analysis of B.burgdorferi genome (a list of suitable PAM sequences & a list of markers for B.burgdorferi detection were made)
Week 8. 29.07 - 04.09
DNA and plasmid sequence generation to TwistBiosciences order
Week 10. 12.08 - 18.08
Primer design for reconstituting the fragments into pET vector
Week 11-13. 19.08 - 08.09
Work on python script to search targets for our CRISPR/Cas9 systems in Borrelia genomes (Borreliella burgdorferi, Borreliella bavariensis, Borreliella afzelii, Borreliella garinii)
Week 14. 09.09 - 15.09
  • The model of two SpCas9 proteins in PAM-out orientation using Chimera
  • The model of SpCas9 and SaCas9 proteins in PAM-out orientation
Week 16. 23.09 - 29.09
The model of two SaCas9 proteins in PAM-out orientation
Week 17. 30.09 - 06.10
Work on python functions to check potential targets in tick genome Ixodes scapularis and in its endosymbionts
Week 18. 07.10 - 13.10
  • Work on a python script to search and check targets
  • Preparation a python script and targets for collaboration with Team NU Kazakhstan
Week 19. 14.10 - 20.10
  • Preparation of a report on modeling CRISPR/Cas9 systems
  • Collaboration with Team NU Kazakhstan to check targets in the Ixodes endosymbionts

Hardware

Week 1. 10.06 - 16.06
  1. Literature search based on types of spectrophotometers and their structure.
  2. Search for various projects related to open biology hardware, DIY hardware, and so on.
  3. Found the following projects related to our topic:
  4. Article about Fourier spectrophotometer at home
  5. The task is to study the principle of operation of Fourier spectrophotometers
Week 2. 17.06 - 23.06
  1. Software search for modeling optical systems:
  2. Search lenses:
  3. Study of absorption spectrum based on Nitrocefin and Renilla luciferase:
  4. Started designing the optical scheme of the device
    • Defined the required basic details for the construction of LimePhoton-M
    • Started modeling the case for LimePhoton-M
    • Started to transfer the design of the optical scheme to the Python script
  5. Studied the basics of work in matplotlib on the example of building a model of an optical system.
  6. Conducted modeling of the Rowland's circle.
    7. Rowland's circle
Week 3. 24.06 - 30.06
Performed modeling of the photometer case "LimePhoton-M" with colored LEDs.
Week 4. 01.07 - 07.07
  1. The first photometer based on esp 8266, OPT101P photodetector, LEDs is assembled.
  2. Worked on the code directly for selecting the led and its brightness. The device is controlled via the monitor port.
  3. Studied the ESP-DASH library to create an interface and display graphs.
Week 5. 08.07 - 14.07
  1. Made changes in the case of the photometer.
  2. Improved the code by introducing the device control through the local Wi-Fi network.
Week 6. 15.07 - 21.07
  1. Made changes in the case of the photometer.
  2. Improved the code by introducing the device control through the local Wi-Fi network produced by the device itself.
Week 7. 22.07 - 28.07
  1. Made changes in the case of the photometer.
  2. Worked on the case for spectrophotometer LimeSpect-X
Week 8. 29.07 - 04.08
  1. Calibration of the prototype photometer LimePhoton-M has been done. Used ultrospec 1100 Pro spectrophotometer from Biochrome, measurements were carried out at a wavelength of 470 nm. The spectrophotometer was calibrated with reference to water. Light-absorbing food dye in the 500 nm zone was used. Its concentration was gradually increased until they reached the value of optical density equal to 1. The calibration results are shown in diagram 1.
    2. Diagram 1
    Diagram 1.
  2. Finished the case for LImePhoton-S
  3. Finished the case for the LimeSpect-X spectrophotometer

MSU
MSU Biological Faculty
MIPT
Sechenov University
AESC MSU
Helicon
Haxus
Nanolek
SkyGen
Qiagen
Evrogen
Invitro
Chroma Technology
Twist Bioscience
Integrated DNA Technologies
New England BioLabs
Unstoppable Technologies
BioSchool Piligrim
institute of fundamental medicine and biology