Team:MITADTBIO Pune/Results
KdpF PROMOTER
The aim of this project is to create a genetically engineered organism that has the capability of releasing extracellular degradation enzymes to deteriorate polyethylene (PE) based sanitary pads. PEred’s success hinges on it detecting K+ levels in its surroundings and using this as a trigger to express a plastic degrading enzyme. To facilitate this, we decided to construct reporter strain to express green fluorescence protein (GFP) using a potassium inducible promoter that is active in presence of menstrual blood.
The potassium promoter sequence used was based on the design BBa_ K1682002 created by iGEM15_HKUST-Rice. We got potassium promoter with modified EcoRI sites synthesized from DeNovo Tech India, which was used as template to amplify the promoter fragment using following primers:
Kdp_F: ATCAGAATTCTGCCATTTTTATACTTTTTT
Kdp_R: CTGAGAATTCCAGAAATCTACCCTTCCGGT
Kdp_F: ATCAGAATTCTGCCATTTTTATACTTTTTT
Kdp_R: CTGAGAATTCCAGAAATCTACCCTTCCGGT
Figure 1. Construction of KdpF promoter in GFP plasmid. Agarose gel electrophoresis of DNA fragments obtained from PCR amplification using Kdp-F and Kdp-R primers 1. Potassium promoter 2. Colony PCR of BBa_K3306002 recombinant plasmid 3. Colony PCR of BBa_E0040. M: 100 bp DNA ladder.
PCR amplification of potassium promoter using forward and reverse primers gave an expected 78 base pair DNA band (Figure 1, Lane 1) As the aim of using KdpF promoter was to control the expression of downstream genes using potassium, it was necessary to quantify the induction of KdpF potassium promoter in E. coli. To construct reporter strains, our PCR amplified promoters was cloned upstream of GFP derived from Aequeora Victoria [BBa_E0040]to construct composite partBBa_K3306002. The resultant plasmid was then transformed in E. coli JM109 competent cells. To check the correct insertion of the fragment, few colonies were sub-cultured and used to extracted plasmids. Colony PCR of the isolated recombinant plasmid was performed using KdpF promoter specific forward and reverse primers gave expected band of 78 bp confirms that potassium promoter is successfully integrated into BBa_E0040 (Figure 1, Lane 2, 3)
Characterizing our promoter repertoire
To establish whether reporter strains could successfully detect the presence of potassium ions, we did an initial fluorescence microscopy test with the reporter strain incubated with 0.5mM potassium.
Figure 2 shows some of the images from this test, where it can be seen that incubation of our reporter strain with potassium leads to increase GFP expression (Figure 2B) compared to basal GFP expression levels in cells grown in absence of potassium. As seen in Figure 2A, transformants grown in the absence of potassium shows very/low basal luminescence level most likely from promoter leaking. E. coli cells alone were used as a negative control (Figure 2C). This result demonstrates that the KdpF promoter is functional and that we successfully created reporter E.coli strain containing GFP under the control of KdpF promoter. This recombinant is able to express GFP using potassium ions as inducible molecules and thus validate our part.
Figure 2 shows some of the images from this test, where it can be seen that incubation of our reporter strain with potassium leads to increase GFP expression (Figure 2B) compared to basal GFP expression levels in cells grown in absence of potassium. As seen in Figure 2A, transformants grown in the absence of potassium shows very/low basal luminescence level most likely from promoter leaking. E. coli cells alone were used as a negative control (Figure 2C). This result demonstrates that the KdpF promoter is functional and that we successfully created reporter E.coli strain containing GFP under the control of KdpF promoter. This recombinant is able to express GFP using potassium ions as inducible molecules and thus validate our part.
To determine the minimum and maximum concentration of potassium required to induce GFP expression, the reporter strain was further analyzed with a dose-dependence study. Transformants with our composite part BBa_K3306002 were grown on LB media. The OD600 of the cells was measured and equalized to 0.1 OD to ensure comparability. The cells were diluted and relative concentration of GFP was recorded in Tecan Infinite m200 fluorescence spectrophotometer at 600nm.
The graph in figure 4 clearly indicates that at different concentrations of potassium, there is also an increase in the expression of GFP, but it is not linear in nature.
Figure 3. Changes in fluorescence with varying potassium ion concentration.
Since the goal of our system is to enable engineered bacteria to sense and trigger the expression of the downstream gene in presence of potassium ions present in blood, after standardizing our part BBa_K3306002 in KCl, we wanted to test its activity in blood. Blood serum was collected as described in protocols. The potassium ion concentration in serum was analyzed using Microlyte electrolyte analyzer.
Electrolyte |
Concentration |
|---|---|
| K+ | 4.3 mM |
| Na+ | 14.3 mM |
| Cl- | 110 mM |
Through the implementation point of view, we decided to evaluate the performance of potassium promoter in presence of blood serum as a source of potassium ions to simulate the conditions in our proposed bioreactor that PEred would be exposed to in the future. This is achieved by growing our transformants in different K+ concentrations which are obtained from diluting serum in LB. Figure 5 suggests that the KdpF promoter starts expressing GFP at different concentrations wherein elevated levels of expression was found at the concentration of 1.7mM. But this was not significantly high compared to remaining potassium concentrations. This clearly indicates that the induction of GFP expression by KdpF promoter remained insensitive to the variation in potassium concentration in serum. We can hypothesize that due to high osmolarity of serum, the expression of Kdp pathway becomes independent of potassium in the environment. This hypothesis would have to be validated with further experiments.
Figure 4. Emission of reporter strain with BBa_K3306002 in presence of serum.
LACCASE
The enzyme laccase is an important part of our genetically engineered organism, as it catalyzes polyethylene deterioration.
The iGEM DNA kit include few laccase enzymes such as BBa_K863000, BBa_K863001, BBa_K863005, BBa_K863006, BBa_K863010, BBa_K863011, BBa_K863020, BBa_K863021, BBa_K729002, BBa_K808025 and BBa_K729002. However except BBa_K808025 (Cutinase) and BBa_K729002 (laccase), all the other laccase have applications concerning bioremediation, detoxification of industrial effluents and wastewater purification. Since we will be using laccase to degrade the plastic component of our used menstrual pads, only two genes qualify for this requirement. Cutinase is well recognized for stimulating Polyethylene terephthalate (PET) hydrolysis and degradation[1]. On the other hand laccase, has been demonstrated to effectively degrade polyethylene[2] and nylon-66[3] by oxidation of the hydrocarbon backbone of polyethylene. Between the two, laccase was selected to be part of our composite part, as sheet of conventional sanitary napkins is made from polyethylene (PE) and polypropylene (PP).
The iGEM DNA kit include few laccase enzymes such as BBa_K863000, BBa_K863001, BBa_K863005, BBa_K863006, BBa_K863010, BBa_K863011, BBa_K863020, BBa_K863021, BBa_K729002, BBa_K808025 and BBa_K729002. However except BBa_K808025 (Cutinase) and BBa_K729002 (laccase), all the other laccase have applications concerning bioremediation, detoxification of industrial effluents and wastewater purification. Since we will be using laccase to degrade the plastic component of our used menstrual pads, only two genes qualify for this requirement. Cutinase is well recognized for stimulating Polyethylene terephthalate (PET) hydrolysis and degradation[1]. On the other hand laccase, has been demonstrated to effectively degrade polyethylene[2] and nylon-66[3] by oxidation of the hydrocarbon backbone of polyethylene. Between the two, laccase was selected to be part of our composite part, as sheet of conventional sanitary napkins is made from polyethylene (PE) and polypropylene (PP).
Cloning of laccase in iGEM backbone plasmid will lead to normal low level of laccase expression which will show in vitro activity, but the activity and expressive rate is non-obvious. For the above reasons, we decided to clone laccase gene is pET28a+ expression vector for sustainable production of laccase.
To insert laccase gene into cloning expression vector (pET 28a+), we first designed prefix and suffix primers which contain EcoRI and PstI restriction enzyme sites respectively. The PCR amplification of laccase gene from BBa_K729002 using EcoRI-prefix and PstI-suffix primers give an expected 1.5 kb DNA band as shown in (Fig. 2).
Primers used to amplify laccase :
EcoRI_Prefix_F: ATGAGAATTCGTTTCTTCGAATTCGCGGCCGCTTCTAG
PstI_Suffix_R: GACTCTGCAGGTTTCTTCCTGCAGCGGCCGCTACTAGTA
The purified PCR amplified products were restriction double digested with EcoRI-PstI, and ligated at same sites in pET28a+ (5.3 kb) expression vector and transformed recombinant plasmid into E. coli (JM109). The transformation result was shown in Figure 3. To check whether the construction was successful, we picked few colonies to extract their plasmids. The inclusion of insert into the recombinant plasmid was verified both by restriction digestion (Fig 3), and DNA sequencing. Our sequencing results with the prefix and suffix primers gave mixed results. The data obtained from sequencing results was aligned to the original biobrick. Since the sequences showed 97% match, this confirmed the insert was successfully cloned and was in correct orientation.
We tested the expression of laccase enzyme by transforming the pET28a+ recombinant carrying pET-laccase gene into E. coli expression strain BL21. To overexpress laccase enzyme, E. coli expression strain BL21 containing laccase gene under IPTG-inducible T7 promoter was induced by 1mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 3hrs and 18 hrs at 37°C, corresponding proteins were separated by 12% SDS-PAGE followed by staining with Coomassie Brilliant Blue G250 (CBB). Prior to induction with IPTG, expression of laccase is not detectable by SDS-PAGE (Figure 4 Lane 1). After IPTG induction recombinant, protein bands of about 58 kDa was observed which is in agreement with the theoretical molecular weight of laccase which is 58.87 kDa (Figure 4 Lane 2).
IN VITRO ACTIVITY ASSAY OF LACCASE
The above gel confirms that the construct is well assembled and successfully synthesize the desired laccase protein. Then, we tested whether expressed laccase is active through enzyme activity experiments. To detect laccase enzyme activity, colorimetric assay was carried out using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) or ABTS method.
The nonphenolic dye ABTS is oxidized by laccase into water soluble chromogen ABTS+ which is more stable and preferred state of the cation radical. ABTS+ can be monitored spectrophotometrically at 420 nm. The concentration of the cation radical responsible for the intense blue-green color can be correlated to enzyme activity and is read at 420nm. The supernatant of overnight grown bacteria culture acted as a source of laccase enzyme. The enzyme activity experiment was carried out by using 100 μL of enzyme and 100 μL of ABTS solution (0. 5 mM) in sodium acetate buffer (pH 5). The enzymatic units (U) defined as the amount of enzyme transforming 1 µmol of substrate per minute is calculated by the following formula:
Equation : U/L = (∆E×Vt)/(ε×d×Vs)
with ∆E being the change in extinction of light [min-1] at 420 nm
ε being the molar absorption coefficient of ABTS [M-1 cm-1]
d being the layer thickness [cm] in your cell that the light has to pass
Vt is the total volume measured and Vs is the volume of the enzyme stock solution added to the ABTS stock solution.
It is demonstrated in Figure 5 by in vitro ABTS assay that recombinant laccase protein can oxidize ABTS. It is essential for our project that recombinant microorganisms should be capable of polyethylene deterioration in the presence of blood and/or dried blood. To check the effect of blood on laccase enzyme activity, we performed the ABTS assay in the presence of different concentrations of blood. It was clearly observed that the laccase activity is not significantly affected by blood (Figure 5).
The nonphenolic dye ABTS is oxidized by laccase into water soluble chromogen ABTS+ which is more stable and preferred state of the cation radical. ABTS+ can be monitored spectrophotometrically at 420 nm. The concentration of the cation radical responsible for the intense blue-green color can be correlated to enzyme activity and is read at 420nm. The supernatant of overnight grown bacteria culture acted as a source of laccase enzyme. The enzyme activity experiment was carried out by using 100 μL of enzyme and 100 μL of ABTS solution (0. 5 mM) in sodium acetate buffer (pH 5). The enzymatic units (U) defined as the amount of enzyme transforming 1 µmol of substrate per minute is calculated by the following formula:
with ∆E being the change in extinction of light [min-1] at 420 nm
ε being the molar absorption coefficient of ABTS [M-1 cm-1]
d being the layer thickness [cm] in your cell that the light has to pass
Vt is the total volume measured and Vs is the volume of the enzyme stock solution added to the ABTS stock solution.
It is demonstrated in Figure 5 by in vitro ABTS assay that recombinant laccase protein can oxidize ABTS. It is essential for our project that recombinant microorganisms should be capable of polyethylene deterioration in the presence of blood and/or dried blood. To check the effect of blood on laccase enzyme activity, we performed the ABTS assay in the presence of different concentrations of blood. It was clearly observed that the laccase activity is not significantly affected by blood (Figure 5).
We were not only able to successfully clone the laccase gene into an expression vector (Figure 3), but we were also able it induces its expression (Figure 4). Finally, we could also show the laccase activity in vitro as well as the influence of blood on laccase enzyme activity (Figure 5).
BIOFILM
Literature survey suggests that biofilm formation on the surfaces of plastic films was important for its degradation[4,5] as well as we wanted to engineer PEred such that it spread across the waste thus rapidly increasing biomass which would eventually lead to rapid degradation of plastic.
The biofilm formation regulator OmpR234 gene from BBa_K342003 was inserted into cloning vector (pGEMT) using strategy as described earlier for laccase gene. Briefly OmpR234 gene were PCR amplified from using PstI prefix and suffix primers. After performing clean up of PCR amplified products, genes were blunt end ligated to vector and transformed recombinant plasmid into E. coli (JM109). The transformants were ascertained by PCR amplification using gene specific primers. PCR using PstI primers prefix suffix primers gives a 651 bp DNA fragment corresponding to intact OmpR234 gene when recombinant plasmid DNA was used as the template.
Primers used to amplify biofilm:
PstI_Prefix_F: ATGACTCCAGGTTTCTTCGAATTCGCGGCCGCTTCTAG
PstI_Suffix_R: GACTCTGCAGGTTTCTTCCTGCAGCGGCCGCTACTAGTA
The biofilm formation regulator OmpR234 gene from BBa_K342003 was inserted into cloning vector (pGEMT) using strategy as described earlier for laccase gene. Briefly OmpR234 gene were PCR amplified from using PstI prefix and suffix primers. After performing clean up of PCR amplified products, genes were blunt end ligated to vector and transformed recombinant plasmid into E. coli (JM109). The transformants were ascertained by PCR amplification using gene specific primers. PCR using PstI primers prefix suffix primers gives a 651 bp DNA fragment corresponding to intact OmpR234 gene when recombinant plasmid DNA was used as the template.
Primers used to amplify biofilm:
PstI_Prefix_F: ATGACTCCAGGTTTCTTCGAATTCGCGGCCGCTTCTAG
PstI_Suffix_R: GACTCTGCAGGTTTCTTCCTGCAGCGGCCGCTACTAGTA
To ascertain the adherence property of the recombinant cells, we used a coverslip based technique[6]. As seen in Fig. 2, after 18 h of growth, recombinant bacteria formed thick and confluent biofilm structures on the coverslip detected after staining with 0.1% crystal violet. The test revealed dark, confluent staining across the surface indicating robust biofilm formation. One representative picture is presented here.
CRYSTAL VIOLET ASSAY
Crystal violet assay was used to measure the biofilm formation capabilities of the transformants and its quantification using microplate method. As illustrated in Figure 3, the noticeable difference between recombinant cell carrying OmpR234 gene as compare to control show distinct extracellular biofilm production in the modified strain.
The crystal violet staining visually illustrates that the expression of OmpR234 in our experiments leads to about 3 times more biofilm compared to the control. The recombinant also increased adhesion to glass coverslips, and we could see a layer of biofilm which remained attached to the glass surface after the washing steps.