Assembled Parts
The following parts were ordered from IDT:
nMag with GGSGG linker (BBa_K3165050)
nMag joined to the N terminal of T7 Polymerase using a GGSGG linker under a double terminator with a weak constitutive promoter.
pMag with mOrange (BBa_K3165054)
pMag joined to the C terminal of T7 Polymerase using the same linker and the same double terminator along with mOrange under a T7 expression system i.e. T7 promoter, RBS and T7 Terminator.
pMag with GP2 (BBa_K3165053)
pMag joined to the C terminal of T7 Polymerase using the same GGSGG linker and the same double terminator along with GP2 under a T7 expression system.
mini-CcaS with Gp2 under modified promoter (BBa_K3165039)
Gp2 under the regulation of modified PcpcG2, with mini-CcaS under a constitutive promoter.
mini-CcaS with ECFP under modified promoter (BBa_K3165041)
ECFP under the regulation of modified PcpcG2, with mini-CcaS under a constitutive promoter. This part was to be used for characterization of CcaSR system.
CcaR along with Ho1 gene and pcyA gene (BBa_K3165036)
CcaR under a strong RBS, along with
Ho1 gene and
pcyA gene under the same constitutve promoter.
i2mcherry with 6xHis tag (BBa_K3165046)
i2mcherry with a 6xHis tag, under a T7 promoter.
DNA Confirmation
Unfortunately as can be seen from the above DNA Confirmation gel image we did not get two DNA Sequences namely pMag with mOrange and CcaS with GP2 which were later reordered from IDT and Genscript.
PCR
The above mentioned sequences ordered from IDT were amplified using the following primers:
Forward Primer: gttgaatcgttgtgtagtacgaattcgc
Reverse Primer: cgtaaccaagttttatggcgctg
Restriction Digest
pMag with GP2/mOrange , CcaR-Ho1-PcyA were digested with EcoRI and PstI along with the pSB1C3 ,pBS1C and pBS4S backbone. nMag and Ccas-GP2 were digested with EcoRI and XbaI. The reason for this disparity was to perform 3A Assembly on our parts at a later stage.
Ligation
We used a 3A assembly which is different from Standard Assembly in the sense that it relies on three way ligation (between the two parts and the backbone vector) for assembly rather than the conventional two way ligation
The above shown ligation was used for the CcaSR System. Similarly for the Opto-T7 System we had