Team:Freiburg/Labbook/MIPD
Click on an item for a detailed description
27.05.2019
Mixed Streptavidin Stock
1.5 mg/mL (10*100 μL aliquots, stored at -20°C) , 100 mM NaCl, 10 mM sodium phosphate (pH 7.2 → 68.4% HNa2PO4 * 2 H2O; 31.6% H2NaPO4 * 2 H2O)
Coating
- Coated 2 different plates for Phage Display (Ph.D.) with PhyB with Streptavidin
- Mixed one strep. aliquot with NaHCO3 (0.1 M) to a final strep. concentration of 122.6 μg/mL
→ enough to coate 7 wells → stored o/n at 4°C in a humidified container, gently shaking.
- For in solution (plate A) coated wells: A1, A6, A12, H1, H12.
- For surface (plate B) coated wells: A1, A12.
28.05.2019
Coating (Target):
- prepare biotinylated PhyB for coating (50 μg/mL in 150 μL 0.1 M NaHCO3)
- slap off the Streptavidin coating solution. Coated Well A1 on Plate B (surface) with PhyB. Well A12 on plate B was refilled with 150 μL NaHCO3 (0,1M)
→ stored plate overnight at 4°C in humidified container, gently shaking.
Preparation of buffers:
- BSA blocking buffer: 5 mg/mL BSA in 0.1 M NaHCO3, 50 mL → stored at 4°C
- Glycine elution buffer (40 mL): 0.2 M Glycin (150.14 mg for 10 mL)*4
1 mg/mL BSA (10mg for 10 mL)*4
pH: 2.2 - TBS (1 L): 50 mM TRIS (6.05 g for 1 L)
150 mM NaCl (8.77 g for 1 L)
pH: 7.5 - PEG/NaCl: 20% PEG (20 g for 100 mL)
2,5 M NaCL (14.61 g for 100 mL) - LB-Media (1 L): dest. H2O, 10 g Bacto Tryptone 5 g yeast extract, 5 g NaCl
- Top-Agar (125 mL): 1.75 g Bacto Tryptone; 0.625 g NaCl; 0.625 g yeast extract; 0.875 g Bacto agar
- 1 M TRIS-HCl (pH 9.1 for neutralizing): 6.05 mg TRIS for 50 mL
29.05.2019
- Aliquoted Phages in 10 aliquots (under hood).
- Added Tween to TBS → TBST 0.1% and 0.5%.
- Mixed solution for 8 IPTG/X-Gal plates (400 mL LB + 40 μL IPTG + 60 μL X-Gal) → Poured onto LB-Plates and incubated at 4°C for 30 min in the dark.
PhyB Panning 1:
- Prepared three cultures of ER2738 in 20 mL LB in a big Erlenmeyer flask at 37°C, shaking at 200 rpm.
- Blocked plates with BSA (1h at 4°C).
- Washed plates 6x with TBST 0.1%.
- Put phages (10 μL Phages + 100 μL TBST 0.1%) on wells A12, A6 (Plate A, in solution panning) and A12 (Plate B, surface panning) for negative selection → Incubated at RT for 30 min, gently shaking.
- Transferred phages to target well (Plate A: A12→ H12; Plate B: A12→ A1), incubated at RT for 1 h, gently shaking.
- Transferred the unbound phages from well A6 by pipetting to a centrifuge tube containing biotinylated PhyB (25 μg/mL in TBST 0.1% → instead of 0.25 μg/mL of NEB protocol), diluted to a final concentration of 50 mg/mL in NaHCO3 (9.9 μL PhyB in 150 μL NaHCO3 ). Incubated at RT for 30 min, gently shaking.
- Transferred the precomplexed phage-target solution to well A1. Incubated at RT for 30 min, gently shaking.
- Transferred the supernatant from well A1 to well H1 (plate A) and refilled the well A1 with 150 μL TBST 0.1% . Incubate at RT for 15 min, gently shaking.
- Washed wells 15 times with TBST 0.1%.
- Added 150 µL of glycin elution buffer to wells A1, H12, A12 (Plate A) and A1 (Plate B) and incubated for 20 min at RT, gently shaking.
- Neutralized by adding 15 µL TRIS-HCL pH 9.1 to the wells. → figured out that we need a higher amount of neutralization buffer, NEB protocol says to add 15 µL to 100 µL EB.
- Mixed eluates from well A1 and A12.
- Transferred the eluates from all wells to a centrifuge tube and stored at 4°C.
- Stored 1 µL of each eluate if needed for later titering.
- Added each phage eluate to ER2738 culture with OD600 0,025 for amplification of phages. Incubated at 37°C shaking at 200 rpm for 4.5 h.
- Transferred the culture to a centrifuge tube and spun for 10 min at 12,000 g at 4°C.
- Transferred the supernatant to a fresh tube and discarded the ER2738 pellet. Re-spun for 10 min at the same velocity.
- First PEG-precipitation:
- Transferred the upper 80% of the supernatant to a fresh tube (~ 11-13 mL) and added 1/6 volume of 20% PEG/2.5 M NaCl. Let sit at 4°C o/n.
Preparation of Xgal/IPTG/LB plates
- Per plate: 40 μL IPTG (0.1 M, dissolved in DMSO), 60 μL Xgal (conc: 20 mg/mL), 400 μL LB. Performed under a hood.
- Stored at 4°C in the dark.
- Coated 2 new streptavidin plates with the same layout as before.
30.05.2019
- Spun down the PEG precipitation at 12,000 g for 15 min at 4°C.
- Discarded the supernatant, Respun for 15 min at same velocity. Pellets weren't visible.
- Discard the remaining supernatant with a pipette, carefully to not disturb the pellet.
- Resuspended the pellet in 1 mL of TBS to solubilize the phages again, vortexed quickly. Transferred suspension to a microcentrifuge tube and spun at 14,000 rpm for 5 min at 4°C.
Second PEG-precipitation:
- Transferred the supernatant to a fresh microcentrifuge tube and added 1/6 of 20% PEG/2.5M NaCl (160 μL).
Change of procedure:
- We suspected that the eluate wasn't added to the cultures on Wednesday which would explain the lack of nice pellets
- Added phage eluates to fresh early-log cultures (OD600 ~0.025). Incubated at 37°C, shaking for 4.5 h.
- Transferred the culture to a centrifuge tube and spun for 10 min at 12,000 g at 4°C.
- Transferred the supernatant to a fresh centrifuge tube and discarded the ER2738 pellet. Respun for 10 min at the same velocity.
- First PEG-precipitation:
- Transferred the upper 80% of the supernatant to a fresh tube (~ 11-13 mL) and added 1/6 volume of 20% PEG/2.5 M NaCl. Let sit at 4°C o/n.
- Prepared 6 new IPTG/X-Gal plates.
31.05.2019
- Well A1 was coated with PhyB as before.
- Inoculated 10 mL LB with a colony from ER2738 plate.
- Spun down the PEG precipitation at 12,000 g for 15 min at 4°C.
- Discarded the supernatant. Respun for 15 min at same velocity.
- Discard the remaining supernatant with a pipette.
- Resuspend the pellet in 1 mL of TBS to solubilize the phages again, vortex quickly. Transferred suspension to a microcentrifuge tube and spun at 14,000 rpm for 5 min at 4°C.
Second PEG-precipitation:
- Transferred the supernatant to a fresh microcentrifuge tube and added 1/6 of 20% PEG/2.5M NaCl (160 μL).
- Incubated on ice for 30 min.
- Spun down PEG precipitation at 14,000 rpm for 10 min at 4°C.
- Stored the supernatant seperatly in a microcentrifuge tube at 4°C and respun at same velocity.
- Removed the residual supernatant and suspend the pellet in 200 μL TBS, vortexed.
Titering:
- Melted Top Agar and poured 3 mL each into a 15 mL centrifuge tube and stored at 45°C to keep liquid.
- Diluted amplified phage solutions in LB medium in the range of 10-1 - 10-7.
- Infected 200 μL of culture OD600 ~0.5 with 10 μL of phage dilutions 10-1, 10-3 - 10-7 at RT for 3 min.
- Added infected cultures to the Top Agar, vortexed quickly and poured it onto the IPTG/X-Gal plates. Let plates cool down for 5 min and incubated at 37°C o/n.
| name | real dilution |
|---|---|
| 10-1 | 10-1 |
| 10-5 | 10-3 |
| 10-6 | 10-4 |
| 10-7 | 10-5 |
| 10-8 | 10-6 |
| 10-9 | 10-7 |
01.06.2019
- Blocked plates A & B with 1% gelatin in TBS (gelatin from Dr. Oetker, dissolve at 45°C, Mat Numb. 7411/088).
Evaluated titer of PhyB Panning 1 amplified
| 10-1 | neg. ctrl: without phages |
neg. ctrl.: |
in solution | surface |
|---|---|---|---|---|
| 10-1 | 0 | >1000 | >1000 | >1000 |
| 10-3 | 35 | ~300 | 54 | |
| 10-4 | 5 | 29 | 12 | |
| 10-5 | 0 | 6 | 1 | |
| 10-6 | 0 | 0 | 0 | |
| 10-7 | 0 | 0 | 0 | |
| 10-8 | 0 | 0 |
Calculated titers: (counted on plates with approx. 100 plaques)
- neg. ctrl. without phages: 0 pfu/μL (10-1 plate)
- neg. ctrl. BSA/Strep. : 3.5 * 104 pfu/μL in 150 μL (in picture: 10-3 plate)
- in solution binding PhyB: 2.9 * 105 pfu/μL in 300 μL (in picture: 10-4 plate)
- surface binding PhyB: 5.4 * 104 pfu/μL in 150 μL (in picture: 10-3 plate)
→ Less than 109 phages in the eluate, NEB protocol says you can take as low as 109 phages for another panning.
→ Eluate needs to be amplified again to get a higher amount of phages.
- Added phage eluates to fresh early-log cultures (20 mL, OD600 ~0.011), incubated at 37°C for 4.5 h at 200 rpm.
- Transferred culture to centrifuge tubes and spun for 10 min at 12,000 g at 4°C.
- Transferred supernatant to fresh centrifuge tubes and re-spun.
First PEG-precipitation:
- Transferred upper 80% (16 mL) of supernatant to a fresh tube and added 1/6 volume of 20% PEG/2.5M NaCl (2.66 ml) → o/n 4°C.
03.06.2019
- Coated plates with streptavidin as before.
- New: NaHCO3
04.06.2019
- Coated plate with PhyB as before (50 μL/mL). → Nothing new other than different dilutions.
- Spun down PEG Precipitation at 12,000 go for 15 min at 4°C.
- Discarded the supernatant. Respun for 15 min at same velocity.
- Discard the remaining supernatant with a pipette.
- Resuspend the pellet in 1 mL of TBS to solubilize the phages again, vortex quickly. Transferred suspension to a microcentrifuge tube and spun at 14,000 rpm for 5 min at 4°C.
Second PEG-precipitation:
- Transferred the supernatant to a fresh microcentrifuge tube and added 1/6 of 20% PEG/2.5M NaCl (160 μL).
- Incubated on ice for 30 min.
- Spun down PEG precipitation at 14,000 rpm for 10 min at 4°C.
- Stored the supernatant seperatly in a microcentrifuge tube at 4°C and respun at same velocity.
- Removed the residual supernatant and suspend the pellet in 200 μL TBS, vortexed.
- Prepared new Top Agar.
- Prepared 17 new IPTG/X-Gal plates.
Titering of double amplified PhyB Panning 1 eluates
- Diluted amplified phage eluates : 10-5 - 10-9 (-ctrl, surf, sol).
- Infected 200 μL of culture OD600 ~0.5 with 10 μL of phage dilutions 10-1, 10-3 - 10-7 at RT for 3 min. Also infected 200 μL culteure with 10 μL of the supernatant of the first PEG precipitation and 200 μL with 10 μL of the supernatant of the second PEG precipitation.
- Added infected cultures to the Top Agar, vortexed quickly and poured it onto the IPTG/X-Gal plates. Let plates cool down for 5 min and incubated at 37°C o/n.
- Prepared 10 mL o/n culture of ER2738 for the plaque amplification at the next day.
05.06.2019
Evaluated titer of double amplified PhyB P1
- All plates were fully overgrown (had >1000 colonies), supernatant one and two showed both homogeneous blue smears.
We assume that titer is about 1013 for solution and 1012 for neg. control and surface (analog to the proportions of the titering from the first amplification)
Calculation of input titer:
For final phage input of 1011 pfu/mL, following dilutions were calculated:
- negative control and surface: 1:100 → 10 μL + 990 μL TBS;
- in solution: 1:1000 → 10 μL + 9990 μL TBS
→ 100 μL used
! Rest was heated to 65°C for 15 min, afterwards stored at 4°C in orange box !
- 12 new IPTG/X-Gal plates.
- Blocked plates with 300 μL 0.1% glatine for 1h. → Not with 1% gelatin as Hanna recommended but like in several recipes on the internet (to avoid gelatinization in our wells).
- Washed 6 times with TBST 0.5%.
- Coated plates with streptavidin.
PhyB Panning 2:
- Added 1011 pfu/mL of phage stock (in TBST) to wells A12, A6 (Plate A, in solution panning) and A12 (Plate B, surface panning) for negative selection. → Incubated at RT for 30 min, gently shaking.
- Transferred phages to target well (Plate A: A12→ H12; Plate B: A12→ A1), incubated at RT for 1 h, gently shaking.
- Transferred the unbound phages from well A6 by pipetting to a centrifuge tube containing biotinylated PhyB (9 μL PhyB in 150 μL TBST), diluted to a final concentration of 50mg/mL in NaHCO3 (9,9 μL PhyB in 150 μL NaHCO3 ). Incubated at RT for 30min, gently shaking.
- Transferred the precomplexed phage-target solution to well A1. Incubated at RT for 30 min, gently shaking.
- Transferred the supernatant from well A1 to well H1 (plate A) and refilled the well A1 with 150 μL TBST 0.5% . Incubate at RT for 15 min, gently shaking.
- Washed wells 15 times with TBST 0.5%
- Added 150 µL of glycin elution buffer to wells A1, H12, A12 (Plate A) and A1 (Plate B) and incubated for 20 min at RT, gently shaking.
- Neutralized by adding 15 µL TRIS-HCL pH 9.1 to the wells.
- Mixed eluates from well A1 and A12
- Transferred the eluates from all wells to a centrifuge tube and stored at 4°C.
- Stored 1 µL of each eluate if needed for later titering.
- Added each phage eluate to ER2738 culture with OD600 0,025 for amplification of phages. Incubated at 37°C shaking at 200 rpm for 4.5 h.
- Transferred the culture to a centrifuge tube and spun for 10 min at 12,000 g at 4°C.
- Transferred the supernatant to a fresh tube and discarded the ER2738 pellet. Respun for 10 min at the same velocity.
- First PEG-precipitation:
- Transferred the upper 80% of the supernatant to a fresh tube (~ 11-13 mL) and added 1/6 volume of 20% PEG/2.5 M NaCl. Let sit at 4°C o/n.
06.06.2019
- Continued with first PEG precipitation.
- Did second PEG precipitation.
- Made new Top Agar (125 mL).
evaluated titer of unamplified eluate of second panning (2.1):
→ No plaques on any plate.
→ Troubleshooting: Maybe the neutralization didn't work well enough? Estimated concentration could have been too low for a second panning.
Titered amplified eluted of panning 1 again
- Diutions: 10-1, 10-3, 10-6
- Coated well A1 on plate B with PhyB.
07.06.2019
Evaluated titer amplified eluate of first panning:
| control | in solution | surface* | dilution |
|---|---|---|---|
| 0 | 0 | 158 | 10-1 |
| 0 | 0 | 2 | 10-3 |
| 0 | 0 | 0 | 10-6 |
→ Contamination of environmental phages or phages that lost the reporter gene (to be determined by sequencing).
- surface: 10-3 : 2 x 103 pfu/μL
10-1 : 1.58 x 103 pfu/μL
Repeated second panning (2.2)
- Blocked plates with 0.1% gelatine.
- Washed plates 6x with 300 μL 0.1% TBST.
- Added 10 μL of phage eluate of first panning in 100 μL TBST 0.1% to wells A12, A6 (Plate A, in solution panning) and A12 (Plate B, surface panning) for negative selection. → Incubated at RT for 1 h, gently shaking.
- Transferred phages from neg. control and surface to target wells A1 (plate B) and H12 (Plate A).
- Transferred the unbound phages from well A6 by pipetting to a centrifuge tube with 50 μL TBST 0.1%, stored at 4°C. → Lacking PhyB as target, thus not possible to continue in solution panning.
- Incubated on target wells for 1h at RT gently shaking.
- Washed wells 15 times with TBST 0.5%.
- Added 150 µL of glycin elution buffer to wells and incubated for 20 min at RT, gently shaking.
- Neutralized by adding 15 µL TRIS-HCL pH 9.1 to the wells.
- Transferred the eluates from all wells to a centrifuge tube and stored at 4°C.
- Stored 2 µL of each eluate at 4°C.
- Amplified the rest of the eluates as before.
- Did First PEG-precipitation.
Titering of unamplified eluates (2.2)
- Titered 1 uL for unamplified eluates at dilutions 10-2 - 10-5.
!!! Xgal Plates had undefined air bubbles, probably from storing them not upside down (used those plates for highest dilution, in case they cause trouble).
plates were at RT for approx. 3h before they were transferred to 37°C
08.06.2019
- Evaluated titer of unamplifed eluates of second panning (2.2).
| dilution | neg. control | surface |
|---|---|---|
| 10-2 | 0 | 0 |
| 10-3 | 0 | 1 |
| 10-4 | 2 | 1 |
| 10-5 | 0 | 2 |
→ No significant results. Won`t perform a third panning.
Plaque amplification:
- Amplified blue plaques according to protocol and stored results at 4°C until sequencing.
- Finished first and second PEG precipitation. Stored amplified eluates at 4°C until needed for titering.
Titering
- Prepared 12 IPTG/X-Gal plates.
- Diluted o/n culture for titering to OD600 0.4.
- Melted Top Agar and poured 3 mL into 12 culture tubes, stored at 45°C.
- Diluted eluates:
Amplified eluates (2.2): -ctrl: 10-1, 10-3 - 10-6
surf: 10-3 - 10-6, 10-8
Unamplified eluates (2.2): -ctrl 10-1, surf 10-1
10.06.2019
Evaluated titer plates from panning 2.2.
→ No plaques (either white or blue) at all. All plates had a strange yellowish color.
12.06.2019
- New E. coli (ER2738) tetracyclin plate.
- New IPTG Stocks in H2O, 0.1 M, stored at -20°C.
Repeated titering of 08.06
13.06.2019
Evaluated titer
No blue plaques on all plates except 3 blue plaques on -ctrl 10-6 and < 10 white plaques.
- Coated plates with streptavidin with the same layout as before.
→ Stored plate overnight at 4°C in humidified container, gently shaking.
19.06.2019
- Coated plate well 1A on plate B with PhyB.
→ Stored plate overnight at 4°C in humidified container, gently shaking.
20.06.2019
Did first panning as before, but used 25 uL Elution Buffer instead of 15 uL
Titering of unamplified eluate panning 1
- Dilutions: 10-1 - 10-5 according to protocol.
- Turned plates over early. → Top agar of in solution plates spilled (except 10-1 and 10-4).
- Amplified the rest of the equate but divided each eluate into two Erlenmeyer flasks with 20 mL culture each to improve amplification step.
- Coated plates with streptavidin.
21.06.2019
- Did first PEG precipitation as before, in the second PEG precipitation we incubated it 1 h instead of 30 min on ice.
Evaluated titer of unamplified eluate panning 1
| negative control | in solution | surface | |
| 10-1 | 156 | 53 | ~560 |
| 10-2 | 24 | 1 | 64 |
| 10-3 | 3 | 0 | 5 |
| 10-4 | 1+5w | 0 | - |
| 10-5 | 0 | 0 | 7-8w |
w) white plaques
⇒ Titer [pfu/10 µL] -ctrl: 2.4 * 103
sol: 5.3 * 102
surf: 6.4 * 103
Titered amplified eluates of panning 1 (-ctrl and surf ; sol )
- Dilutions: -ctrl and surf: 10-6 - 10-10
sol: 10-5 - 10-9
- Coated plate with PhyB (well A1 on Plate B)
22.06.2019
- Coated plates with streptavidin.
Evaluted titer of amplified titer Panning 1
- Only 1 small blue plaque on neg. ctrl 10-6 and sol. 10-5. (8.00 after 15h at 37°C)
→ Left it at 37°C to let grow further.
- Titers are estimated to be <106 pfu/10 µL (<108 pfu/mL) for -ctrl and surf and <105 pfu/10 µL (<107 pfu/mL) for sol.
- Used as input for next panning (2.1) 90 µL of the eluate.
→ The remaining 100 µL will be amplified again for panning 2.2.
Panning 2.1
- Blocked with 0.1 % gelatin in ddH2O
- Used TBST 0.1% for this panning
- Eluted 20 min and neutralized with 25 µL Tris-HCl instead of 15 µL.
→ Kept 5 µL of eluates for titering and later use.
→ Amplified the rest of the eluates in OD600 0.06 cultures, split the eluates again into two erlenmeyer flasks to improve amplification step.
Titering of unamplified eluate P2.1
- Dilutions: 10-1 - 10-4
- Let plates cool down for 15 min at RT, incubated at 37°C o/n.
- Performed PEG precipitation as before.
23.06.2019
Evaluated titer of unamplified eluates P2.1
- One plaque on 10-1 dilutions of solution and surface, 2 plaques on negative control.
- Finished PEG precipitations as before with 1 h incubation time on ice.
titered amplified eluate P2.1
- Dilutions: 10-2 - 10-6
- Amplified the other half of the amplified eluate from the first panning again in a culture with OD600 0.05 for 4.5 h.
- Preformed first PEG precipitation.
Colony PCR of plaques
- Diluted primers (M13KE forward and reverse) from 100 μM to 10 μM in nuclease free water.
- Picked 5 colonies each (sol, surf and -ctrl) from panning 1 ua.
- Picked all plaques form panning 2.1 ua (2x -ctrl, 1x sol, 1x surf).
- Picked 1 plaque each from -ctrl and sol of ampl. panning 1.
Mix for colony PCR:
| Green Dream Taq Mastermix | 25 μL |
| Nuclease free water | 15 μL |
| Primer 10 μM M13KE for | 5 μL |
| Primer 10 μM M13KE rev | 5 μL |
Picked plaques with a pipette tip, shortly swirled it in the PCR tubes, filled with the PCR Mastermix and then placed in a culture tube containing 1 mL of an 1:100 dilution of an overnight (ER2738) E. coli culture for amplification.
PCR Program - colony PCR
| step | temperature (°C) | time | repetitions |
| initial denaturation | 95 | 10min | - |
| denaturation | 95 | 30s | 35x |
| annealing | 48 | 40s | 35x |
| elongation | 72 | 60s | 35x |
| final elongation | 72 | 7min | - |
- Casted a 1,5% agarose gel, wrapped in a plastic bag for the next day, stored at 4°C.
24.06.2019
- Finished PEG precipitation.
- Blocked plates fore 2 h with 0.1% gelatine, slapped of remaining solution and added 300 μL TBS. → Stored at 4°C (decided not to do a panning because input titer was too low).
DNA Extraction and purification:
Run gel (1% agarose, 3 μL Midori) according to plan.
| UA p1 | |||||||||||||
| ladder | H2O | -ctrl 1 | -ctrl 2 | -ctrl3 | -ctrl4 | -ctrl 5 | sol 1 | sol 2 | sol 3 | sol 4 | sol 5 | surf 1 | surf 2 |
| UA p1 | UA P2.1 | AP1 | |||||||||||
| ladder | surf 3 | surf 4 | surf 5 | -ctrl 1 | -ctrl 2 | sol 1 | surf 1 | -ctrl | sol |
- Loaded 10 μL of each PCR product
- Bands had approx. 600-700 bp length (expected to be 638 bp)
- Purified the fragments (with Nucleospin Gel & PCR CleanUp Kit from Machery Nagel). → Sent for sequencing.
- Transferred the culture to a microcentrifuge tube and spun for 10 min at 12,000 g at 4°C.
- Transferred the supernatant to a fresh microcentrifuge tube. Resuspended the E. coli pellet in 500 μL LB and added 1:1 glycerol to every microcentrifuge tube. Stored stocks at -20°C.
24.06.2019
Titering of Phage Stock (control)
- Dilutions: 10-1 - 10-4
Titering of 2x ampl. eluate P1
- Dilutions: -ctrl 10-6 - 10-9
sol and surf 10-6 - 10-10
Test of amplification conditions 1:
| OD600 | time for amplification | |
| A (standard like NEB protocol) | 0.05 | 4 h 30 min |
| B (longer) | 0.05 | o/n (~19 h ) |
| C (higher OD) | 0.4 | 4 h 30 min |
| D (higher OD and longer) | 0.4 | o/n (~19 h ) |
- Infected all cultures with 175 μL diluted phages in glycine elution buffer and neutralization buffer as it would be in the phage eluate after a panning (containing 1.75*104 phages).
- Started PEG precipitation of 4.5 h amplification eluates.
25.06.2019
Evaluated titer of phage stock
| dilution | plaques |
| 10-1 | 106 |
| 10-2 | 9 |
| 10-3 | 2 |
| 10-4 | 2 |
- Estimated titer: 1.06*102 pfu/μL →1.06*105 pfu/mL
→ Measured titer for test amplification fits to the amount of phages after plaque amplification.
- Continued with purification of phages.
26.06.2019
Titered test amplifications:
- Dilutions: 10-4 - 10-10
27.06.2019
Evaluation of titer:
→ All plates looked the same, blue and white plaques all over (Looked like a contamination with other E. coli species).
29.06.2019
Amplification test 2:
- Diluted phage stock 1013 pfu/mL → 105 pfu/mL in glycin elution buffer + neutralization buffer (100 μL elution buffer + 15 μL neutralisation buffer).
- Did PEG Precipitation with different ODs and amplification times:
OD 0.043 → 4.5 h (10:10) → PEG (15:00)
OD 0.055 o/n (10:10) → PEG (21:00)
OD 0.3 4.5 h (10:30) → PEG (15:00)
OD 0.3 o/n (10:30) → PEG (21:00)
→ Prepared new 20% PEG/2.5 M NaCl solution.
- Did first PEG precipitation after time listed above, stored at 4°C o/n.
- Made a new IPTG/X-Gal with ER2738.
30.06.2019
- Continued PEG precipitation
→ Let pellet dissolve in TBS for 1 h at 4°C after First PEG-precipitation
Titering of amplification test 2:
- Titered range 10-4 to 10-10
01.07.2019
Evaluated titer of amplification test 2:
(→ Input titer was: 1.5*10-4 pfu in 115 μL)
Plaque counts:
| dilution | OD: 0.05, 4.5 h | OD: 0.05, o/n | OD: 0.4, 4.5 h | OD: 0.4, o/n |
| 10-4 | - | 2 | 29 | >100 |
| 10-5 | - | 1 | 3 | 57 |
| 10-6 | - | - | 1 | 6 |
| 10-7 | - | - | - | 1 |
| 10-8 | - | - | - | - |
| 10-9 | - | - | - | |
| 10-10 | - | - | - | |
| titer [pfu/mL] | - | 2*103 | 3*104 | 6*105 |
02.07.2019
Changes for test 3:
- OD600 0.4 culture → Longer amplification: 12 h, 14 h and 16 h.
- Longer 2nd PEG precipitation: 2 h.
- Split amplification cultures, one half only with one PEG precipitation, resuspended in 300 μL TBS, other half as before.
Inoculated three amplifying cultures, added 115 μL of diluted phage stock.
03.07.2019
PEG Precipitations:
- Spun down cultures after 12 h (+20 min at 4°C), 14 h, 16 h → separated in 2x 8-9 mL and added 1/6 of 20% PEG/2.5 M NaCl for first precipitation; stored at 4°C.
- Spun down first PEG-precipitation, discarded supernatant.
- Added 300 μL of TBS to 12 h (1x PEG), 14 h (1x PEG), 16 h (1x PEG).
- Added 1 mL of TBS to 12 h (2x PEG), 14 h (2x PEG), 16 h (2x PEG).
- For resuspension of pellet, let shak at 250 rpm at 4°C for 1 h 15 min.
- Made new IPTG/X-Gal plates
04.07.2019
Titered test 3:
- Dilutions: 10-4 - 10-9
05.07.2019
Evaluated titer of test 3:
| 12-1 | 12-2 | 14-1 | 14-2 | 16-1 | 16-2 | |
| 104 | a lot | 10 | a lot | 60 | a lot | 32 |
| 105 | a lot | 1 | a lot | 6 | ~ 336 | 4 |
| 106 | a lot | 1 | 81 | 4 | 132 | 4 |
| 107 | 81 | - | 13 | 1 | 15 | 4 |
| 108 | 12 | - | 3 | 0 | 2 | 1 |
| 109 | 1 | - | - | 3 | - | 5 |
Amplification test 4:
- OD6000.5 with amplification time of 4.5 h, 7 h and 9 h and only one (first) PEG precipitation.
06.07.2019
- Spun down PEG and suspended pellet in 300 μL TBS, 1 h shaking at 4°C, vortexed for 10 s. Stored at 4°C o/n.
07.07.2019
- Transferred eluates to microcentrifuge tubes.
- New IPTG/X-Gal.
Titered eluates form test 4:
- Dilutions: 10-4 - 10-9
- New NaHCO3 0.1 M stock.
- Coated plates with streptavidin 75 μL in 1125 μL 0.1 M NaHCO3 → 15 μg per well in 150 μL.
08.07.2019
Evaluated titer of test 4:
→ All plates were blue.
⇒ Titered same eluates again with same dilutions.
09.07.2019
| dilutions | 4.5 h | 7 h | 9 h |
| 10-4 | many | many* | many |
| 10-5 | many | many* | many |
| 10-6 | 216 | >300* | 280 |
| 10-7 | 70 | 100 | 72 |
| 10-8 | 86 | 98 | 59 |
| 10-9 | 60 | 58 | 54 |
*) The plate was fully white, we probably forgot IPTG/X-Gal on those plates.
New anti-contamination procedure:
- General cleaning of the whole lab with Javel water (bleach)
- When picking E. coli only use pipetts form the same sterile box and don`t turn the E. coli plate upside.
- Make a new E. coli tet-plate every week.
- Adding tetracyclin to IPTG/X-Gal plates and LB media for amplification.
- Made all solutions new.
10.07.2019
Amplification test 5:
| Media | Preincubation | Incubation | |
| A | LB + tet | - | 5 h |
| B | LB + tet | 30 min | 4.5 h |
| C | LB | - | 5 h |
| D | LB | 30 min | 4.5 h |
- Started with PEG-precipitation.
11.07.2019
- Cleaned the whole lab with bleach (0,6%) and water.
- Finished PEG-precipitation.
Titered eluates from test 5:
→ All plates were blue.
12.07.2019
- Made new IPTG/X-Gal plates.
Repeated amplification test 5
- Started PEG-precipitation.
13.07.2019
- Finished PEG-precipitation.
- New IPTG/X-Gal/Tet plate with E. coli → 37°C
Titered eluates test 5.2
- Dilutions: 10-5 - 10-11
- Implemented controls:
- Only top agar
- Top agar + 200 μL titering culture
- Top agar + 10 μL amplified eluate w/o E. coli
- Top agar + 10 μL of 10-4 diluted phage stock + 200 μL titering culture
14.07.2019
Evaluated titer of test 5.2:
Controls:
| only top agar | - |
| top agar + 200 μL titering culture | - |
| op agar + 10 μL of 10-4 diluted phage stock + 200 μL titering culture | - |
| top agar + 10 μL amplified eluate | many colonies |
Amplification tests:
| dilution | A - LB + tet w/o preincubation | B - LB + tet 1/2 hr preincubation | C - LB 1/2 hr preincubation | D - LB w/o preincubation |
| 10-5 | 66 | 165 | 60 | 59 |
| 10-6 | 7 | 17 | 7 | 4 |
| 10-7 | 1 | - | - | - |
| titer in pfu/mL | 7*105 | 1.7*106 | 6*105 | 5.9*105 |
| titer in pfu/μL | 7*108 | 1.7*107 | 6*108 | 5.9*108 |
Amplification test 6:
- Diluted phage stock to 105 pfu/mL in 100 μL elution buffer and 15 μL neutralization buffer.
- Added 20 μL to E. coli culture (OD600 0.45), afterwards added 115 μL of phage solution.
- Preincubated for 30 min at 37°C.
- Let cultures incubate for 4.5 h at 200 rpm and o/n at 150 rpm.
- Started PEG-precipitation.
15.07.2019
- finished PEG-precipitation as before
Titered eluates of test 6
- Dilution:10-4- 10-10
- Titered titering culture as negative control.
16.07.2019
Evaluation of titer:
| dilution | New protocol | old protocol |
| 10-4 | >100 | >100 |
| 10-5 | 520 | 424 |
| 10-6 | 79 | 36 |
| 10-7 | 6 | 3 |
| 10-8 | 2 | - |
| 10-9 | - | - |
| 10-10 | - | - |
| titer in pfu/μL | 6*106 | 3.6*105 |
| titer in pfu/mL | 6*109 | 3.6*108 |
→ New protocol: o/n, 150 rpm, 1/2 h preincubation, 1.5 h TBS.
→ Reference: 4.5 h, 200 rpm, o/n, 1 h TBS.
⇒ new protocol is more sufficient
16.07.2019
Preparation of ELISA Plates
- Made PSMα3 (D+PEG+Biotin) coating solution → 6.6 μM in H2O → 100x
- Coated streptavidin plates (min. one week old) with PSMα3.
→ 1.5 μL coating solution, 148.5 μL NaHCO3
New Buffers
- NaHCO3
- BSA Blocking Buffer
- TBST 0.1%
- Glycin elution buffer (pH 2.2)
- Tris-HCl neutralization buffer
- NaH2PO4 and Na2HPO4 (31.6% NaH2 68.4% Na2H Mixture)
17.07.2019
Blocking:
- Slapped off the remaining coating solution. Added 300 µL of blocking solution (5 mg/mL BSA in 0.1 M NaHCO3). Incubated at 4°C for 1 h.
- Did solution and surface panning according to protocol, used for washing step 0.1% TBST.
- Eluted phages with 100 µL elution buffer for 20 min and neutralized with 15 µL neutralization buffer.
Titered P1 ua
- Dilutions : 10-1 - 10-4
- Negative controls: titering culture and amplifying cultures.
Amplification of phages P1
- Amplifying culture had OD600 0.5 and tetracycline was added, before adding the eluates.
- Preincubated cultures for 30 min at 37°C, no shaking.
- Let cultures shake at 200 rpm at 37°C, o/n.
18.07.2019
Evaluated titer of P1 ua
| dilution | solution | surface | negative ctrl |
| 10-1 | 2 | 480 | >480 |
| 10-2 | 9 | 36 | 100 |
| 10-3 | 0 | 5 | 11 |
| 10-4 | 0 | 0 | 0 |
| titer [pfu/µL] | 9*101 | 4*102 | 103 |
| titer [pfu/mL] | 9*104 | 4*105 | 106 |
- Did PEG Precipitation
Titered P1 a
Dilutions: 10-5 - 10-9
Coated new plates for P2
- Coated with Streptavidin (8:00AM) and coated with target (10:49PM).
19.07.2019
Evaluated titer of P1 a
| dilution | neg. ctrl | surface | in solution |
| 10-5 | >100 | >100 | >100 |
| 10-6 | 156 | 256 | 106 |
| 10-7 | 18 | 27 | 6 |
| 10-8 | 0 | 2 | 2 |
| 10-9 | 0 | 0 | 2 |
| titer [pfu/µL] | 1.5*107 | 2.7*107 | 6*106 |
| titer [pfu/mL] | 1.5*1010 | 2.7*1010 | 6*109 |
→ Input titer high enough for a second panning
2nd panning PSMα3
Blocked plates with gelatine 0.1% in ddH2O.
input: 0.9*109 phages
| -ctrl | sol | surf |
| 150 μL | 37 μL | 66.6 μL |
- Used TBST 0.1% for washing plates.
- For elution of phages added 150 μL elution buffer instead of 100 μL because phages were added in 150 μL.
Amplification of phages P2
- 40 min preincubation, then cultures with tetracycline at 200 rpm, 37°C, o/n.
Titered P2 ua
- Dilution: 10-1 - 10-4
- Coated plates with streptavidin
20.07.2019
Evaluated titer of P2 ua
| -ctrl | surf | sol | |
| 10-1 | 23 | 31 | 3 |
| 10-2 | - | 1 | - |
| 10-3 | - | - | - |
| 10-4 | - | - | - |
| titer [pfu/mL] | 2.3*104 | 3.1*104 | 3*103 |
| total phages | 4.025*103 pfu/mL [175 μL] | 5.4*103 pfu/mL [175 μL] | 1.05*103 pfu/mL [350 μL] |
Both controls were negative.
- Bleached culture tubes & autoclaves
- Did PEG precipitation
Plaque amplification:
- Diluted 10 μM Primers.
- Mixed Master Mix for 47x colony PCR (25 μL Taq Master Mix + 5 μL Primer + 15 μL H2O) + piqued plaques from P2 ua.
- Amplified the phages from these plaques in 2 mL E. coli culture OD600 ~0.068 at 37°C, ~190 rpm for 4.5 h:
- P2 ua: 10 -ctrl, 32 surf, 3 sol
- P1 ua: 5 -ctrl, 10 surf, 10 sol
- Coated new plates with D-PSMα3 (10 μL coating sol. in 150 μL NaHCO3).
- Spun down cultures from plaque amplification after ~5 h at 14,000 rpm, 3 min.
- Took 1 mL supernatant and made a 1:1 glycerol stock, stored at -20°C.
- Left ~300 μL supernatant with pellet, resuspended the pellet and also made 1:1 glycerol stocks, stored at -20°C.
Titered P2 a
- Dilution: 10-3 - 10-8
21.07.2019
Evaluated titer of P2 a
| -ctrl | sol | surf | |
| 10-3 | >100 | >100 | >100 |
| 10-4 | >100 | >100 | >100 |
| 10-5 | >100 | >100 | >100 |
| 10-6 | 134 | ~336 | 172 |
| 10-7 | 17 | 45 | 17 |
| 10-8 | >100 (weird) | 10 | 2 |
| [pfu/μL] | 1.7*107 | 4.5*107 | 1.7*107 |
| [pfu/ml] | 1.7*1010 | 4.5*1010 | 1.7*1010 |
| total phages in 300 μL |
5.1*109 | 1.35*109 | 5.1*109 |
Panning 3.1
- Blocked plates for 1 h 30 min with BSA
- Input: 2.465*109 phages
| -ctr | sol | surf |
| 145 μL | 54.6 μL | 145 μL |
- Attention put phages on wrong wells on plate B.
- 1 h 30 min incubation on target well for surface panning → eluted phages, put for negative selection 30 min on control well and took unbound phages in a microcentrifuge tube
- Did in solution panning according to protocol with 10 μL D-PSMα3 (6.666 M).
- Used TBST 0.5% for washing plates.
Titered P3.1 ua
- Dilutions: 10-1 - 10-4
- Control: titering culture
22.07.2019
Evaluated titer of P3.1 ua
| -ctrl | sol | surf | |
| undiluted | no plate | 16 | no plate |
| 10-1 | - | 4 | 3 |
| 10-2 | - | - | - |
| 10-3 | - | - | - |
| 10-4 | - | - | - |
- Titer culture control was negative
Titered some of P3.1 again
- undiluted: 10 μL of surf and -ctrl
23.07.2019
Evaluated titer of P3.1 (undiluted)
Both plates were fully blue. → Contamination, forgot the titer culture as negative control.
- Performed colony PCR and purified gels
Titered some of P3.1 again
- Undiluted: 10 μL of surf and -ctrl
Wednesday 24.07.2019
- Picked more plaques of P3.1 ua
- 20 plaques of solution → made a cPCR of 10 plaques
- 20 plaques of surface → made a cPCR of 10 plaques
- 5 plaques of negative control → made a cPCR of all of them
- Colony PCR as before
| #1 | H2O | c3.1 | c3.2 | c3.3 | c3.4 | c3.5 | s3.1 | s3.2 |
| #2 | s3.3 | s3.4 | s3.5 | s3.6 | s3.7 | s3.8 | s3.9 | s3.10 |
| #3 | f3.1 | f3.2 | f3.3 | f3.4 | f3.5 | f3.6 | f3.7 | f3.8 |
| #4 | H2O | f3.10 |
loading plan
- Incubated 2 mL cultures with plaques for 4.5 h at 37°C, 200 rpm / cultures of stripe #1 at 30°C, 200 rpm.
- Added to 1 mL of each culture 500 µL glycerol, stored at -20°C.
- Gel-extraction of PCR products. → Look at gel pictures D-PSMa3 round 1
25.07.2019
- Coated plates with streptavidin.
26.07.2019
- Coated plates with D-PSMα3 10 µL in 150 µL NaHCO3
27.07.2019
- Coated strep as before for (12 wells). → New system and layout for coating.
Panning 1:
- Blocked with 0.1% gelatin. → Changed order of blocking (gelatin → BSA → gelatin).
- Washed 6x with TBST 0.5% → Before TBST 0.1%
- Added phages to -ctrl wells.
- Eluted wells with 100 µL elution buffer, 20min and added 15 µL neutralization buffer.
Titered P1 ua
- 115 µL of surf/-ctrl eluates → used 1 µL for titering dilutions 10-1 - 10-4
- 460 µL of sol eluate → used 10 µL for a "undiluted" plate and 1 µL for dilutions 10-1 - 10-3
- Amplified eluates according to protocol
28.07.2019
- Pelleted cells
- Volumes of o/n cultures were less as expected, cell pellets were as big as with 20 mL volume
- -ctrl 7 mL
- sol 18 mL
- surf 10 mL
- Did PEG precipitation
Evaluated titer of P1 ua
| -ctrl | sol | surf | |
| undiluted (10 µL) | - | >100 | - |
| 10-1 | >100 | >100 | >100 |
| 10-2 | 18 | 31 | 130 |
| 10-3 | 9 | 1 | 15 |
| 10-4 | 1 | - | 2 |
- Controls were negative
- Coated plates with D-PSMα3 10 µL coating sol in 160 µL NaHCO3.
- Spun down PEG eluates, added 300 µL TBS, let shake > 1 h 30 min at 4°C.
Titered P1 a
Dilutions: 10-5 - 10-9
29.07.2019
Evaluated titer of P1 a
| -ctrl | sol | surf | |
| 10-5 | >300 | 112 | >300 |
| 10-6 | ~250 | 32 | ~520 |
| 10-7 | 38 | 3 | 73 |
| 10-8 | 2 | 1 | 5 |
| 10-9 | - | - | 1 |
| titer [pfu/mL] | 3.8*1010 | 3.2*109 | 7.3*1010 |
| total phages in 300 µL | 1.14*1010 | 9.6*108 | 2.19*1010 |
- Control was negative
- Input for 2nd panning (109 phages)
- -ctrl: 26.31 µL
- sol: 2x 150 µL á 4.8*108 phages
- surf: 13.7 µL
Panning 2:
- Blocked plates with BSA, washed with TBST 0.5%
- Eluted with 150 µL elution buffer per well added 15 µL neutralization buffer after 20 min
Titered P2 ua
- 115 µL of surf/-ctrl eluates → used 1 µL for titering dilutions 10-1 - 10-4
- 460 µL of sol eluate → used 10 µL for a "undiluted" plate and 1 µL for dilutions 10-1 - 10-3
- Coated plates with streptavidin for 3rd panning
Amplified eluates of P2
30.07.2019
Evaluated titer of P2 ua
| -ctrl | sol | surf | |
|
undiluted (10 µL) |
- | 3 | - |
| 10-1 | 2 | - | 6 |
| 10-2 | - | - | 1 |
| 10-3 | - | - | - |
| 10-4 | - | - | - |
- Control were negative.
- Coated D-PSMα3 10 µL coating sol in 160 µL NaHCO3.
- Spun down PEG eluates, added 300 µL TBS, let shake for 1 h at 4°C.
Titered P2 a
- Dilutions: 10-4 - 10-8
31.07.2019
Evaluated titer of P2 a
| dilution | neg. control | surface | solution |
| 10-4 | >100 | >100 | >100 |
| 10-5 | ~240 | ~200 | ~320 |
| 10-6 | 41 | 58 | 40 |
| 10-7 | 9 | 12 | 9 |
| 10-8 | 0 | 1 | 1 |
| titer [pfu/ml] | 4,1*109 | 5,8*109 | 4*109 |
| total phages in 300 µl [pfu/ml] | 1,36*109 | 1,93*109 | 1,33*109 |
| input for 3rd panning | 147,76µl | 103,125µl | 150µl |
Panning 3.1
- Blocked with BSA, washed with 0.5% TBST.
- Eluted sol with 100 µL elution buffer + 15 µL neutralisation buffer.
- ctrl and surf with 150 µL elution buffer + 25µL neutralization buffer.
Titered P3 ua
- Dilutions: undiluted (10 µL), 10-1, 10-2
- Coated plates with streptavidin [9:30AM]
- Coated plates with D-PSMα3 [9:30PM]
01.08.2019
Panning 3.2
- Repeated panning 3.1 with rest of the eluate of P2 a → -ctrl was only 138 µL instead of 147 µL
- Blocked plates with galtine, washed 6x with 0.5% TBST.
- New top Agar.
Titered P3.2 ua
- Dilutions: undiluted (10 µL), 10-1, 10-2
- Picked plaques from P2 ua → Did plaque amplification.
Evaluated titer of P3.1 ua
- Contamination with white colonies. → New ER2738 plate (+Tet, w/o IPTG/X-Gal).
| -ctrl | sol | surf | |
| undiluted (10 µL) | 8 | 12 | 19 |
| 10-1 | - | - | 2 |
| 10-2 | - | - | - |
02.08.2019
Evaluated titer of P3.2 ua
| - ctrl | sol | surf | |
| undiluted (10 µL) | 12 | 10 | 54 |
| 10-1 | 1 | 0 | 5 |
| 10-2 | - | - | 1 |
- Picked 20 plaques from surf, 10 from -ctrl for a colony PCR, cultivated those and all other plaques in 1 mL LB for 4.5 h , 37°C 200 rpm. Stored with additional 500 µL glycerol at -20°C.
- Loaded PCR products onto gel (1% agarose).
Titered P3.2 ua
- 40 µL of sol again
03.08.2019
- 44 plaques on sol undiluted (40 µL) plate
- Colony PCR of 20 new plaques from sol undiluted plate
- Did gel extraction
02.08.2019
- Dissolved IZN24 (Protein from M. Kay), D- and L-version.
- For coating solution: diluted to 6.6 µM of IZN24 in PBS pH 5.8 → Took 1.5 µL for 10 pmol coating (10 µL to have excess).
- Coated Strep plate with 10 µL IZN24 solution in 160 µL in PBS pH 5.8.
- New IPTG/X-Gal/Tet plate.
03.08.2019
Panning 1
- Blocked with BSA.
- Washed PBST pH 5.8 (0.1% Tween).
Amplified eluates of P1 ua
Titered P1 ua:
- Dilutions: 10-1 - 10-4
04.08.2019
- After amplification different culture volumes
- Pelleted cells and did PEG precipitation
- Spun down PEG precipitation, resuspended in 300 µL PBS, shaking for 1 h 30 min
Evaluated titer of P1 ua
| -ctrl | surf | sol | |
| 10-1 | >500 | >500 | >500 |
| 10-2 | 81 | >100 | >100 |
| 10-3 | 11 | >300 | 37 |
| 10-4 | 1 | 47 | 3 |
| titer [pfu/mL] | 1.1*106 | 4.7*107 | 3.7*106 |
- Prepared P3 D-PSMα3 to send for sequencing, Primer: -96III
- New ER2768 IPTG/X-gal/Tet plate.
- Coated plate with IZN24 (10 µL in 150 µL PBS pH 5.8).
Titiered P1 a:
- Dilutions: 10-4 - 10-8
05.08.2019
Evaluated titer of P1 a
| -ctrl | sol | surf | |
| 10-4 | >100 | >100 | >100 |
| 10-5 | 56 | 20 | >100 |
| 10-6 | 7 | 2 | 58 |
| 10-7 | 1 | - | 7 |
| 10-8 | - | - | 2 |
| titer [pfu/mL] | 5.6*105 | 2*105 | 5.8*106 |
| total phages in 300 µL PBS | 5.6*108 | 2*108 | 5.8*109 |
| input for P2 | 150 µL | 300 µL | 25.86 µL |
Panning 2
- Blocked with gelatin.
- Washed with 0.1% PBST.
Titered P2 ua
- Dilutions 10-1 - 10-4
| #1 | H2O | c3.1 | c3.2 | c3.3 | c3.4 | c3.5 | s3.1 | s3.2 |
| #2 | s3.3 | s3.4 | s3.5 | s3.6 | s3.7 | s3.8 | s3.9 | s3.10 |
| #3 | f3.1 | f3.2 | f3.3 | f3.4 | f3.5 | f3.6 | f3.7 | f3.8 |
| #4 | H2O | f3.10 |
06.08.2019
- Spun down cultures to pellet cells and did PEG precipitation.
→ While purification of phages supernatant of sol. amplification culture with phages was discarded.
Evaluated titer of P2 ua
| dilution | -ctrl | surf | sol |
| 10-1 | 23 | 6 | 19 |
| 10-2 | 2 | 0 | 4 |
| 10-3 | 0 | 6 | 0 |
| 10-4 | 0 | 0 | 0 |
Titered P2 a
- Dilutions: 10-4 to 10-8
Wednesday 07.08.2019
- Analyzed sequencing results: !Put grafics here!
Evaluation of titer P2 a
| -ctrl | surf | |
| 10-4 | 32 | 22 |
| 10-5 | 3 | 1 |
| 10-6 | - | - |
| 10-7 | - | - |
| 10-8 | - | - |
| titer [pfu/mL] | 3.2*107 | 2.2*107 |
→ Too low input titer for 3rd round of panning
08.08.2019
- Picked plaques from IZN24 P2 ua.
- 10 -ctrl, all for colony PCR
- 12 surf, 5 for colony PCR (f1-4, f10)
- 14 sol, 5 for colony PCR (s1-4, s10)
- Did colony PCR according to prtocol, afterwards gel-extraction and send for sequencing.
10.08.2019
- Inoculated 10 µL of glycerin stock of s11-15 and f5-9 in 5 mL LB at 30°C, 200 rpm, o/n.
Sunday 11.08.2019
- Did colony PCR.
| Green Dream Taq Mastermix | 25 µL |
| Nuclease free water | 13 µL |
| Primer 10 µM M13KE for (GCTAAGTAACATGGAGCAGG) | 5 µL |
| Primer 10 µM M13KE rev (CCCTCATAGTTAGCGTAACG) | 5 µL |
| phage containing E. coli culture | 2 µL |
- Did gel-extraction of each.
12.08.2019
- Send everything for sequencing
Sequences:
15.08.2019
Phage ELISA 1.0
- Inoculated 200 mL LB with 5 µL glycerin stock of Phage Display 2 with PSMα3 P3 clones c1, s1 and f1 at 30°C, w/o shaking, o/n.
16.08.2019
- Spun down cultures for 3 min at 2272 g.
Titered phage containing supernatant
- Dilutions: 10-1 - 10-3, 10-5
- Coated ELISA plates with straptavidin for Phage ELISA (8:00AM)
- Coated plate with PSMα3 (7:00PM).
- Inoculated 6 µL of glycerol stocks in 250 mL LB in 96-well plate at 37°C w/o shaking .
17.08.2019
Evaluated titer of phage containing supernatant
| c1 | s1 | f1 | |
| 10-1 | >2000 | >2000 | >2000 |
| 10-2 | >2000 | >2000 | >2000 |
| 10-3 | >2000 | >2000 | >2000 |
| 10-4 | ~1544 | ~1250 | >2000 |
| titer [pfu/µL] | ~1.5*107 | ~1.25*107 | >2*107 |
| input in 100 µL | 1.5*109 | 1.25*109 | 2*109 |
Phage ELISA 1.0
- Blocked plates with BSA 1 h 30 min with BSA.
- Washed plates 4 times with 300 μL TBST 0.1%.
- Pelleted cells at 12,000g, 3 min, 4°C.
- Added 90 μL of supernatan (containing phages) to target coated well and incubated for 1 h 30 min at 37 °C, on shaker at RT.
- Washed plates 6 times with 150 μL TBST 0.1%.
- Added 100 μL of HRP-conjugated anti-M13 antibody (1:5000, Sino Biological, Inc., Beijing), incubate for 2 h at 37°C.
- Washed plates 3 times with 150 μL TBST 0.1%.
- Added 150 μL of TMB to plate C.
- Stopped reaction on plate C with 75 μL 2 M sulfaric acid after about 5 min.
- Added 100 μL of TMB to plate A&B.
- Stopped reaction on plate C with 50 μL 2 M sulfaric acid after about 5 min.
- Used a platereader to detect absorbance at 450 nm.
- Coated new plates with streptavidin.
18.08.2019
Evaluated titer →
→ all plates were totally blue, had also a contamination on negative control of titering culture
- coated plates with PSMα3
- inoculated 6 µL of glycerol stocks in 250 mL LB in 96-well plate at 37°C w/o shaking.
19.08.2019
Phage ELISA 2.0
μL TBST 0.1%.
μL of supernatan (containing phages) to target coated well and incubated for 1 h 30 min at 37 °C, on shaker at RT.
μL TBST 0.1%.
μL of HRP-conjugated anti-M13 antibody (1:5000, Sino Biological, Inc., Beijing), incubate for 2 h at 37°C.
μL TBST 0.1%.
- Added 100 μL of TMB.
μL 2 M sulfaric acid after 2 min 45 s.
Titered best 5 clones of phage display with PSMα3
- Ph. D. #1 sol9 → A
- Ph. D. #2 sol17 → B
- Ph. D. #2 surf8 → C
- Ph. D. #2 surf27 → D
- Ph. D. #2 surf11 → E
- Dilutions: 10-6, 10-8, 10-10, 10-12
20.08.2019
- Inoculated 100 μL of glycerol stocks A-E in 20 mL LB, incubated at 37°C at 250 rpm o/n
Evaluated titer of A-E
| A | B | C | D | E | |
| 10-6 | 206 | >300 | >300 | >300 | >300 |
| 10-8 | - | 3 | 4 | 11 | 3 |
| 10-10 | - | - | - | - | - |
| 10-12 | - | - | - | - | - |
| titer [pfu/mL] | 2*107 | 3*107 | 4*107 | 1.1*108 | 3*107 |
| phages in 100 μL | 2*109 | 3*109 | 4*109 | 1.1*1010 | 3*109 |
- Spun down cultures for 3 min at 2272 g.
- Did PEG precipitation, resuspended pellet in 300 μL TBS for 2 h added 1/6 volume of 20% PEG/2.5 M NaCl →used this on Monday 26.08.
- Amplified phage clones Ph. D. #2 surf8 and #2 -ctrl2.
- Started PEG precipitation.
22.08.2019
- Did PEG precipitation, resuspended pellet in 300 μL TBS for 2 h.
Titered all eluates
- #1 sol9 → 1
- #2 sol17 → 2
- #2 surf8 → 3
- #2 surf11 →4
- #2 -ctrl2 → 5
- #2 surf27 → 6
- Dilutions: 10-8, 10-10, 10-12, 10-14
23.08.2019
Evaluated titer:
→ No plaques.
24.08.2019
Evaluated titer:
| dilution | 1 | 2 | 3 | 4 | 5 | 6 |
| 10-5 | ~214 | 0 | 84 | ~200 | >1000 | 50 |
| 10-6 | 22 | 0 | 7 | 7 | ~504 | 0 |
- Did PEG precipitation and added TBS
- Inoculated 15 glycerol stock of clones 1-6 in 3 mL LB and incubated for 12 h.
- Pelleted cells
Titered cultuers 1-6
- Dilutions: 10-5 - 10-8 for phages in TBS
10-6 - 10-8 for phages in LB (in the supernatant)
- Heated supernatants to 65°C for 3 min. Stored at -20°C.
25.08.2019
Evaluated titer
| dilutions | 1 | 2 | 3 | 4 | 5 | 6 |
| LB 10-6 | 43 | 4 | ~20 | 77 |
>1000 |
37 |
| LB 10-7 | - | - | 37 | 8 | ~200 | 1 |
| LB 10-8 | - | - | 3 | 2 | 33 | 0 |
| titer [pfu/μL] | 4.3*106 | 4*105 | 3.7*107 | 8*106 | 3.3*108 | 3.7*106 |
| phages in 10 μL | 4.3*108 | 4*107 | 3.7*109 | 8*108 | 3.3*1011 | 3.7*108 |
| PEG 10-5 | - | - | 12 | - | >1000 | - |
| PEG 10-6 | - | - | 2 | - | >1000 | - |
| PEG 10-7 | - | - | - | - | 151 | - |
| PEG 10-8 | - | - | - | - | 19 | - |
Phage ELISA 3.0
- Blocked plates with BSA 2 h with BSA.
- Washed plates 4 times with 300 μL TBST 0.1%.
- Pelleted cells at 12,000g, 3 min, 4°C.
- Added 100 L of LB with 4*107 phages each to target coated well and incubated for 2 h at 37 °C, on shaker at RT.
- Washed plates 6 times with 150 μL TBST 0.1%.
- Added 100 μL of HRP-conjugated anti-M13 antibody (1:5000, Sino Biological, Inc., Beijing), incubate for 2 h at 37°C.
- Washed plates 3 times with 150 μL TBST 0.1%.
- Added 100 μL of TMB.
μL 2 M sulfaric acid after 3 min and 15 min.
26.08.2019
- Inoculated 100 μL PEG from Tuesday 20.08 plus 10 μL of matching glycerol stock in 1 mL LB. (colonies 1-6).
- Incubated 30 min w/o shaking at 37°C, afterwards at 200 rpm o/n.
- Coated plates with streptavidin
- New IPTG and X-Gal stocks
Tuesday 27.08.2019
- Prepared new glycerol stocks of colonies 1-6 out of o/n cultures.
Titered
- Dilutions: 10-6 - 10-8
- Control on self made top agar IPTG/X-Gal plate.
28.08.2019
Evaluated titer
| 1 | 2 | 3 | 4 | 5 | 6 | |
| 10-6 | >300 | >300 | >300 | >300 | >300 | >300 |
| 10-7 | >200 | >200 | >200 | >300 | >300 | ~250 |
| 10-8 | 117 | 73 | 53 | 172 | 245 | 35 |
| titer [pfu/μL] | 1.17*109 | 7.3*108 | 5.3*108 | 1.72*109 | 2.45*109 | 3.5*108 |
| in 100 μL | 1.17*1011 | 7.3*1010 | 5.3*1010 | 1.72*1011 | 2.45*1011 | 3.5*108 |
- Control was contaminated but probably because of the self made agar plate
- Blocked plates with BSA 1 h 30 min with BSA.
- Washed plates 4 times with 300 μL TBST 0.1%.
- Pelleted cells at 12,000g, 3 min, 4°C.
- Added 100 μL of LB with 3.5*1010 phages each to target coated well and incubated for 1 h 30 min at 37 °C, on shaker at RT.
- Washed plates 6 times with 150 μL TBST 0.1%.
- Added 100 μL of HRP-conjugated anti-M13 antibody (1:5000, Sino Biological, Inc., Beijing), incubate for 2 h at 37°C.
- Washed plates 3 times with 150 μL TBST 0.1%.
- Added 100 μL of TMB.
- Stopped reaction with 100 μL 2 M sulfaric acid after 2 min 30 s.
- Used a platereader to detect absorbance at 450 nm.
