Team:Freiburg/Labbook/In Vitro Corporation
Click on an item for a detailed description
12.06.2019
Set up two PCR reactions with primers that contain mutations to insert an AMBER- and a phenylalanine mutation inside the chromophore of sfGFP at residue 66 in the plasmid pBAD
Settings PCR:
Initial Denaturation 95°C for 30 seconds
Denaturation 95°C for 10 seconds
Anealing 55°C for 20 seconds
Elongation 72°C for 90 seconds
Ending Elongation 72°C for 120 seconds
in total 30 cycles
Load PCR samples on a 1% agarose gel and run it for 25 minutes
Cut out the specific band and perform a gel extraction with QIAGEN Gel Extraction Kit
For ligation mix:
17 µl PCR product
2 µl T4 DNA Ligation Buffer
1 µl T4 Ligase
incubate overnight at 4°C
13.06.2019
Digest template DNA by adding 1 µl DPN1 enzyme to ligation product from yesterday
Perform a transformation with 5 µl of each plasmid (sfGFP in pBAD) in 50 µl Top10 competent cells.
Plate 100 µl of each plasmid on an agar plate with chloramphenicol and incubate overday at 37°C.
1. Plate: sfGFP with AMBER mutation inside the chromophore at residue 66 (pBAD plasmid)
2. Plate: sfGFP with L-Phe mutation inside the chromophore at residue 66 (pBAD plasmid)
Pick three colonies from each plate and grow a 4 ml culture in LB + Chloramphenicol and incubate overnight at 37°C
14.06.2019
Perform a Miniprep with both cultures with QIAGEN Miniprep Kit and send 10 µl to Eurofins for sequencing.
Results: Cloning worked, mutations are introduced in both constructs.
In vitro protein expression with PURExpress Kit from NEB
Assemble following reactions:
1. Positive control
10 µl solution A
7.5 µl solution B
5.5 µl nuclease-free water
2 µl DHFR DNA
2 µl RNasin RNase inhibitor
2. minC
10 µl solution A
7.5 µl solution B
3 µl nuclease-free water
4.5 µl minC DNA in pET28
2 µl RNasin RNase inhibitor
mix gently and spin down
incubate for 2 hours at 37°C
stop the reaction by placing samples on ice
Run samples on a 12% tris-tricine precast gel:
15 µl of the sample
5 µl Lämmli buffer
denaturation for 5 minutes at 95°C
run the gel for 1 hour at 100-120 V
Stain the gel with Instant Blue solution for 1 hour
Result: No specific band was distinguishable.
Repeat expressions with and without RNase inhibitor.
17.06.2019
In vitro protein expression with PURExpress Kit from NEB
Assemble following reactions:
1. Positive control
10 µl solution A
7.5 µl solution B
3 µl nuclease-free water
4.5 µl minC DNA in pET28
2 µl RNasin RNase inhibitor
2. minC
10 µl solution A
7.5 µl solution B
5 µl nuclease-free water
4.5 µl minC DNA in pET28
mix gently and spin down
incubate for 3.5 hours at 37°C
stop the reaction by placing samples on ice
Run samples on a 12% tris-tricine precast gel:
15 µl of the sample
5 µl Lämmli buffer
denaturation for 5 minutes at 95°C
run the gel for 2 hour at 100-120 V (comment: samples got stuck at the middle of the gel)
Stain the gel with Instant Blue solution for 1 hour
Result: The samples got stuck in the middle of the gel, therefore the gel was run for a longer time which led to the samples running out of the gel. The gel is uninterpretable. Also there was no negative control as a reference.
Repeat the expression with a negative control. Also only load 2.5 µl of each sample on the gel.
28.06.2019
Protein Synthesis Reaction using PURExpress (E6800)
expression was performed as described in the protocol
following amounts were used:
Control:
Solution A: 10 µl
Solution B: 7.5 µl
Murine RNase Inhibitor NEB: 1 µl
Nuclease-free water: 6.5 µl
DHFR = Dihydrofolatereductase (control template provided by NEB in the kit):
Solution A: 10 µl
Solution B: 7.5 µl
Murine RNase Inhibitor NEB: 1 µl
Nuclease-free water: 4.5 µl
DHFR DNA template: 2 µl
minC:
Solution A: 10 µl
Solution B: 7.5 µl
Murine RNase Inhibitor NEB: 1 µl
Nuclease-free water: 0.5 µl
minC DNA template: 6 µl
Comment: wrong amount of DNA template was used because of a calculation mistake
29.06.2019
Electrophoresis of Mini Protean TGX 12 Precast Gel from BioRad:
Sample preparation:
Take 2.5 µl of each sample
Add 2.5 µl Laemmli 4X Buffer
Add 5 µl bidest. H2O
cook at 95°C for 3 min.
Load gel with 7 µl Color Protein Standard Broad Range from NEB and the samples
Run the gel at 200 V for 1.5 h
Comment: samples got stuck in the middle of the gel because the wrong buffer (TBST) was used
30.06.2019
Electrophoresis of Mini Protean TGX 12 Precast Gel from BioRad (12% Tris-Glycine):
Sample preparation:
Take 2.5 µl of each sample
Add 2.5 µl Laemmli 4X Buffer
Add 5 µl bidest. H2O
cook at 95°C for 3 min.
Load gel with 7 µl Color Protein Standard Broad Range from NEB and the samples
Run the gel at 200 V for 30 minutes
Instant Blue Staining
pour Instant Blue Solution on the gel so that it is covered
incubate it for 30 min - 1 hour
01.07.2019
Amplification of eYFP in a pet28 plasmid with Kanamycin resistance
Transformation as described in the protocol
02.07.2019
Protein Synthesis Reaction using PURExpress (E6800):
expression was performed as described in the protocol
following amounts were used:
Control:
Solution A: 10 µl
Solution B: 7.5 µl
Murine RNase Inhibitor NEB: 1 µl
Nuclease-free water: 6.5 µl
DHFR = Dihydrofolatereductase (control template provided by NEB in the kit):
Solution A: 10 µl
Solution B: 7.5 µl
Murine RNase Inhibitor NEB: 1 µl
Nuclease-free water: 4.5 µl
DHFR DNA template: 2 µl
minC:
Solution A: 10 µl
Solution B: 7.5 µl
Murine RNase Inhibitor NEB: 1 µl
Nuclease-free water: 3 µl
minC DNA template: 3.5 µl
Electrophoresis with Mini Protean Precast Gel 16.5% Tris-Tricine:
2.5 µl of each sample (Cntrl., DHFR, minC)
Add 7.5 µl 2X TSB Loading Buffer
cook at 95°C for 4 minutes
Take 5 µl of Color Protein Standard and mix it with 5 µl 2X TSB Loading Buffer
load 10 µl of each sample on a Mini-Protean Precast Gel 16.5% Tris-Tricine
Run the gel at max 100 V for 2 h
stain the gel with Instant Blue for 30 minutes
Troubleshooting Electrophoresis:
Take more 2X TSB Loading Buffer if the sample go up in the well
Amplification of eYFP plasmid:
colonies were picked and incubated at 37°C on the shaker for 6 hours as described in the protocol
03.07.2019
Miniprep with eYFP Plasmid containing bacteria done by a QIAGen robot:
Sent 10 µl sample to Eurofins for sequencing
Clonation of AMBER mutation outside the chromophor of sfGFP:
Set a PCR as described in the protocol with following primers:
Amber Forward Test: TCTGTCCGTGGAGAGGGTG
rv_sfGFP_mut_AMBER_Test: TTTGTGCCCATTAACATCAC
and sfGFP in pBADfp plasmid as DNA template
PCR settings:
Initial Denaturation 95°C for 30 seconds
Denaturation 95°C for 10 seconds
Anealing 55°C for 20 seconds
Elongation 72°C for 90 seconds
Ending Elongation 72°C for 120 seconds
30 cycles in total
Electrophoresis with agarose gel:
Use a 1% agarose gel
mix it with 5 µl Ethidiumbromid
Add 5 µl Gel Loading Dye Purple (6X) to the PCR product
Load the first well of the gel with 5 µl Gene Ruler 1 kb DNA Ladder
Run the gel at 150 mV for 25 minutes
Gel extraction:
Use QIAquick Gel Extraction Kit Protocol
Ligation:
17 µl extracted PRC product
add 2 µl 10X T4 DNA Ligation Buffer
add 1 µl T4 DNA Ligase
incubate over night at 4°C
04.07.2019
Repetition of electrophoresis with expression samples from 02.07.19 using a Mini Protean TGX Precast Gel 12% Tris-Glycine
2.5 µl of each sample (Cntrl., DHFR, minC)
Add 2.5 µl 4X Laemmli Sample Buffer
Add 5 µl bidest. water
cook for 3 minutes at 95°C
load gel with 5 µl of Color Protein Standard and 10 µl of each sample on a Mini-Protean Precast Gel 12% Tris-Glycine
Run the gel at max 200 V for 35 minutes
stain the gel with Instant Blue for 30 minutes - 1 h
Clonation of AMBER mutation outside the chromophor:
Transformation in plates with antibiotics:
Add to ligated DNA samples:
0,5 µl DPN1
incubate for an hour at 37°C
Thaw bacteria on ice (Top 10 competent E. Coli (Ag Di Ventura, BIOSS))
take 50 µl bacteria
add 5 µl ligated PCR DNA
incubate 30 minutes on ice
heat shock at 42°C for 45 seconds
put them back on ice for 2 minutes
add 500 µl LB medium (make sure it’s transparent)
incubate on shaker at 37°C for 45-60 min (not longer)
start worming plates (Chloramphenicol plates should be prewarmed for 60 minutes)
plate 100-200 µl bacteria on the plate
In vitro protein expression with PURExpress Kit from NEB:
Used amounts:
Control:
Solution A: 5 μl
Solution B: 2.75 μl
RNase Inhibitor: 0.5 μl
Nuclease-free H2O: 4.25μl
---------------------------------------------------------------------
Total: 12.5 μl
eYFP:
Solution A: 5 μl
Solution B: 2.75 μl
RNase Inhibitor: 0.5 μl
Nuclease-free H2O: 2.6 μl
Template DNA: 1.65 μl
---------------------------------------------------------------------
Total: 12.5 μl
Electrophoresis of Mini Protean TGX 12 Precast Gel from BioRad (12% Tris-Glycine):
Sample preparation:
Take 2.5 µl of each sample
Add 2.5 µl Laemmli 4X Buffer
Add 5 µl bidest. H2O
cook at 95°C for 3 min.
Load gel with 7 µl Color Protein Standard Broad Range from NEB and the samples
Run the gel at 200 V for 30 minutes
Instant Blue Staining
pour Instant Blue Solution on the gel so that it is covered
incubate it for 30 min - 1 hour
05.07.2019
Run a native gel with the in vitro expression samples from 04.07.19
Visualize the fluorescence with the Typhoon
08.07.2019
Clonation of AMBER mutation outside the chromophore:
pick one colony in a glass tube with 2 ml LB medium with antibiotics
incubate at 37°C in an incubator on a shaker for a few hours
09.07.2019
Clonation of AMBER mutation outside the chromophore:
miniPrep, as described in the Qiagen Protocol.
Use 750 µl for a Glycerol stock
add 250 µl Glycerol
store it at -80°C
you may use it for amplification of your plasmid (after it was sequenced)
take a little bit of it and let it grow in the incubator at 37°C with LB medium
sent 10 µl sample to Eurofins for sequencing
In Vitro Expression of eYFP (pET28a Plasmid) with NEB PURExpress delta RF123 Kit:
eYFP:
Solution A: 10 µl
Solution B: 7.5 µl
Release factor 1: 0.5 µl
Release factor 2: 0.5 µl
Release factor 3: 0.5 µl
Murine RNase Inhibitor: 0.5 µl
Nuclease-free H2O: 2.92 µl
DNA Template: 2.58 µl
Control:
Solution A: 10 µl
Solution B: 7.5 µl
Release factor 1: 0.5 µl
Release factor 2: 0.5 µl
Release factor 3: 0.5 µl
Murine RNase Inhibitor: 0.5 µl
Nuclease-free H2O: 5.5 µl
Mix all components and incubate for 2 hours at 37°C (more information available in protocols)
Run a native gel (6%) with the samples and measure fluorescence signal with the Typhoon
6% native gel:
MQ 13 ml
Acryl amide 2 ml
5X TBE 2 ml
20% Glycerol 1 ml
APS 10% 150 ml
TEMED 15 ml
11.07.2019
Gibson Assembly
Backbone: pET28-minC
Insert: sfGFP, sfGFP-AMBER66, sfGFP-Phe66
PCR
1,5 µl Primer forward (20 µM)
1,5 µl Primer reverse (20 µM)
1 µl DNA Template
11 µl bidest. H2O
15 µl Phusion Flash Master Mix
Settings PCR:
Initial Denaturation 95°C for 30 seconds
Denaturation 95°C for 10 seconds
Annealing 52°C for 20 seconds
Elongation 72°C for 90 seconds
Ending Elongation 72°C for 120 seconds
in total 30 cycles
Gibson Assembly:
Backbone: pET28-minC
Insert: ASLOV-Domain
PCR:
1,5 µl Primer forward (20 µM)
1,5 µl Primer reverse (20 µM)
1 µl DNA Template
11 µl bidest. H2O
15 µl Phusion Flash Master Mix
Settings PCR:
Initial Denaturation 95°C for 30 seconds
Denaturation 95°C for 10 seconds
Annealing 50-55°C (gradient) for 20 seconds
Elongation 72°C for 90 seconds
Ending Elongation 72°C for 120 seconds
in total 30 cycles
Electrophoresis with agarose gel:
Use a 1% agarose gel
mix it with 5 µl Ethidiumbromid
Add 5 µl Gel Loading Dye Purple (6X) to the PCR product
Load the first well of the gel with 5 µl Gene Ruler 1 kb DNA Ladder
Run the gel at 150 mV for 25 minutes
Gel extraction:
Use QIAquick Gel Extraction Kit Protocol
13.07.2019
Gibson Assembly
Continuation from 11.07.19
measurement of PCR construct concentrations
calculation of neccesary amount of backbone and inserts with NEBio Calculator
| Name | Concentration [ng/µl] | Lenght [bp] | Ratio (insert:backbone) |
| Backbone pET28 | 24.2 | 5369 | 3:1 |
| Insert sfGFP | 51.7 | 717 | 3:1 |
| Insert sfGFP-Phe66 | 54.5 | 717 | 3:1 |
| Insert sfGFP-AMBER66 | 52.5 | 717 | 3:1 |
Set up following reactions:
| Sample | 1 | 2 | 3 |
| Backbone pET28 [µl] | 2 | 2 | 2 |
| Insert sfGFP [µl] | 2.5 | 0 | 0 |
| Insert sfGFP-Phe66 [µl] | 0 | 3 | |
| Insert sfGFP-AMBER66 [µl] | 0 | 0 | 3 |
| HiFi Master Mix | 4.5 | 5 | 5 |
Incubate 15 min at 50°C
Perform a DPN1 digest by adding 0.5 µl to each sample and incubate it for 1 hour at 37°C
Perform a transformation:
Thaw bacteria on ice (Top 10 competent E. Coli (Ag Di Ventura, BIOSS))
take 50 µl bacteria
add 5 µl ligated PCR DNA
incubate 30 minutes on ice
heat shock at 42°C for 45 seconds
put them back on ice for 2 minutes
add 500 µl LB medium (make sure it’s transparent)
incubate on shaker at 37°C for 45-60 min (not longer)
start worming plates (Chloramphenicol plates should be prewarmed for 60 minutes)
plate 100-200 µl bacteria on the plate
incubate at 37°C overnight
14.07.2019
Repetition transformation with Gibson Assembly DNA from 13.07.019:
Gibson product: pET28-sfGFP, pET28-sfGFP_Phe66, pET28-sfGFP_AMBER
Thaw bacteria on ice (Top 10 competent E. Coli (Ag Di Ventura, BIOSS))
take 50 µl bacteria
add 5 µl DNA
incubate 30 minutes on ice
heat shock at 42°C for 45 seconds
put them back on ice for 2 minutes
add 500 µl LB medium (make sure it’s transparent)
incubate on shaker at 37°C for 45-60 min (not longer)
start worming plates (Kanamycin)
plate 100-200 µl bacteria on the plate
incubate at 37°C over night
15.07.2019
pick one colony from each plate and put it in a glass tube with 2 ml LB medium with Kanamycin
incubate at 37°C in an incubator on the shaker for a few hours
samples:
pET28-sfGFP 1
pET28-sfGFP 2
pET28-sfGFP 3
pET28-sfGFP_Phe66 1
pET28-sfGFP_Phe66 2
pET28-sfGFP_Phe66 3
pET28-sfGFP_AMBER66 1
pET28-sfGFP_AMBER66 2
pET28-sfGFP_AMBER66 3
Use 750 µl for a Glycerol stock
add 250 µl Glycerol
store it at -80°C
you may use it for amplification of your plasmid (after it was sequenced)
take a little bit of it and let it grow in the incubator at 37°C with LB medium
Performed a MiniPrep with the QiaGen machine
Sequencing showed that Gibson Assembly worked for all constructs. MinC is still in the plasmid but should not be translated
Order a second sequencing to see if mutation is still correct as previous sequencing was too short
16.07.2019
Cloning of AMBER mutation outside the Chromophore of sfGFP
Set 4 different PCR samples:
1. with both primers (forward and reverse)
2. with only the forward primer and pBAD-sfGFP as template
3. with only the reverse primer and pBAD-sfGFP as template
4. with both primers and the pET28-sfGFP plasmid as template
Primers:
Mut_AMBER-outChr_FWD
| Sequence (5'->3') |
GTT AAT GGG CAC AAA TAG TCT GTC CGT GGAGAG |
| Physical Property |
|
Mut_AMBER_outChr_rev
| Sequence (5'->3') |
CTC TCC ACG GAC AGA CTA TTT GTG CCC ATTAAC |
| Physical Property |
|
DNA Template:
pBAD-sfGFP
pET28-sfGFP
samples 1. and 4.:
1,5 µl Primer forward (20 µM)
1,5 µl Primer reverse (20 µM)
1 µl DNA Template
11 µl bidest. H2O
15 µl Phusion Flash Master Mix
samples 2. and 3. :
1,5 µl Primer forward/reverse (20 µM)
1 µl DNA Template
12.5 µl bidest. H2O
15 µl Phusion Flash Master Mix
Settings PCR:
Initial Denaturation 95°C for 30 seconds
Denaturation 95°C for 10 seconds
Annealing 69°C for 20 seconds
Elongation 72°C for 90 seconds
Ending Elongation 72°C for 120 seconds
in total 30 cycles
Mix samples 2. and 3. to bring complementary strands together and get a whole plasmid construct (25%)
Heat to 98°C and let cool down to room temperature to enable the binding.
Put on ice and perform a DPN1 digest:
Add 0.5 µl DPN1
incubate for an hour at 37°C
Transformation:
Thaw bacteria on ice (Top 10 competent E. Coli (Ag Di Ventura, BIOSS))
take 50 µl bacteria
add 5 µl PCR DNA (1, 2+3, 4)
incubate 30 minutes on ice
heat shock at 42°C for 45 seconds
put them back on ice for 2 minutes
add 500 µl LB medium (make sure it’s transparent)
incubate on shaker at 37°C for 45-60 min (not longer)
start worming plates (2 Chloramphenicol plates and one Kanamycin)
plate 100-200 µl bacteria on the plate
incubate at 37°C over night
Result next day: no colonies grew.
--> repeat transformation
--> order 5’Phos-Primers
17.07.2019
Repetition transformation with the cloning product of AMBER outside the chromophore:
Transformation:
Thaw bacteria on ice (Top 10 competent E. Coli (Ag Di Ventura, BIOSS))
take 50 µl bacteria
comprise the DNA in the vacuum centrifuge to 5 µl
add 5 µl PCR DNA (1, 2+3, 4)
incubate 30 minutes on ice
heat shock at 42°C for 45 seconds
put them back on ice for 2 minutes
add 500 µl LB medium (make sure it’s transparent)
incubate on the shaker at 37°C for 45-60 min (not longer)
start worming plates (2 Chloramphenicol plates and one Kanamycin)
plate 100-200 µl bacteria on the plate
incubate at 37°C overnight
Result: no colonies. Repeat the whole cloning.
18.07.2019
Repetition Cloning of AMBER mutation outside the Chromophore of sfGFP
Set up a PCR :
1. with both primers (forward and reverse)
Primers:
Mut_AMBER-outChr_FWD
| Sequence (5'->3') |
GTT AAT GGG CAC AAA TAG TCT GTC CGT GGAGAG |
| Physical Property |
|
Mut_AMBER_outChr_rev
| Sequence (5'->3') |
CTC TCC ACG GAC AGA CTA TTT GTG CCC ATTAAC |
| Physical Property |
|
DNA Template:
pBAD-sfGFP
sample 1.
1,5 µl Primer forward (20 µM)
1,5 µl Primer reverse (20 µM)
1 µl DNA Template
11 µl bidest. H2O
15 µl Phusion Flash Master Mix
Settings PCR:
Initial Denaturation 95°C for 30 seconds
Denaturation 95°C for 10 seconds
Annealing 69°C for 20 seconds
Elongation 72°C for 90 seconds
Ending Elongation 72°C for 120 seconds
in total 30 cycles
Electrophoresis with agarose gel:
Use a 1% agarose gel
mix it with 5 µl Ethidiumbromid
Add 5 µl Gel Loading Dye Purple (6X) to the PCR product
Load the first well of the gel with 5 µl Gene Ruler 1 kb DNA Ladder
Run the gel at 150 mV for 25 minutes
Gel extraction:
Use QIAquick Gel Extraction Kit Protocol
Ligation:
17 µl extracted PRC product
add 2 µl 10X T4 DNA Ligation Buffer
add 1 µl T4 DNA Ligase
incubate over night at 4°C
20.07.2019
Miniprep with the Qiagen Robotor:
sample: E.coli culture with pBAD-sfGFP
resistance: Chloramphenicol
Use 750 µl for a Glycerol stock
add 250 µl Glycerol
store it at -80°C
you may use it for amplification of your plasmid (after it was sequenced)
take a little bit of it and let it grow in the incubator at 37°C with LB medium
22.07.2019
Cloning AMBER outside the Chromophore in sfGFP:
PCR Protocol:
Primer FWD: 5'Phos TAGTCTGTCCGTGGAGAGGGTGAAG 3'
Primer REV: 5'Phos TTTGTGCCCATTAACATCACCATCTAATTCAAC 3'
Materials:
Phusion Flash Master Mix (dilute 1:1)
General:
0,5-2 µM Primer
up to 100 ng Template
fill up to 15 µl with bidest. H2O
1,5 µl Primer forward (20 µM)
1,5 µl Primer revers (20 µM)
1 µl DNA Template
11 µl bidest. H2O
15 µl Phusion Flash Master Mix
Settings PCR:
Initial Denaturation 95°C for 30 seconds
Denaturation 95°C for 10 seconds
Annealing 59.5°C for 20 seconds
Elongation 72°C for 90 seconds
Ending Elongation 72°C for 120 seconds
in total 30 cycles
Electrophoresis with agarose gel:
Use a 1% agarose gel
mix it with 5 µl Ethidiumbromid
Add 6 µl Gel Loading Dye Purple (6X) to the PCR product
Load the first well of the gel with 5 µl Gene Ruler 1 kb DNA Ladder
Run the gel at 150 mV for 25 minutes
Gel extraction:
Use QIAquick Gel Extraction Kit Protocol
Ligation:
17 µl extracted PRC product
add 2 µl 10X T4 DNA Ligation Buffer
add 1 µl T4 DNA Ligase
incubate overnight at 4°C
23.07.2019
Transformation in plates with antibiotics:
Add to ligated DNA samples:
0,5 µl DPN1
incubate for an hour at 37°C
Thaw bacteria on ice (Top 10 competent E. Coli (Ag Di Ventura, BIOSS))
take 50 µl bacteria
add 5 µl ligated PCR DNA
incubate 30 minutes on ice
heat shock at 42°C for 45 seconds
put them back on ice for 2 minutes
add 500 µl LB medium (make sure it’s transparent)
incubate on shaker at 37°C for 45-60 min (not longer)
start worming plates (Chloramphenicol plates should be prewarmed for 60 minutes)
plate 100-200 µl bacteria on the plate
incubate at 37°C overnight
24.07.2019
AMBER cloning outside the chromophore of sfGFP:
pick one colony in a glass tube with 4 ml LB medium with chloramphenicol
incubate at 37°C in incubator on shaker for a few hours.
25.07.2019
Mini Prep with Qiagen Robotor of AMBER outside Chromophore samples
Elution volume 30 µl
sent 10 µl of each sample (overall 4 samples) for sequencing to eurofins
a glycerol stock of each sample is stored at -80°C
31.07.2019
Cell Extract Preparation:
| C321A delta AMBER | control |
| 450 mL of TB medium | 450 mL of TB medium |
| 450 µl Ampicillin | |
| 80 µl C321A competent cells | 80 µl MG1655 competent cells |
incubate bacteria overnight in this media at 30°C and 180 rpm
02.08.2019
Set up Tris acetate:
meassured pH = 8.08
| component | amount | concentration [mM] |
| Trisma base | 30.25 g | 303 |
| Acetic acid (100%) | 10 mL | |
| dd H2O | 90 mL |
Set up a S30 Buffer:
| component | amount | concentration [mM] |
| Tris-acetate pH 8.08 | 33 mL | 10 |
| Magnesium acetate | 2 g | 12 |
| Potassium acetate | 5.89 g | 60 |
| Dithriotheitol (1 M | 2 mL | 2 |
| dd H2O | 965 mL |
Set up the culture:
| C321A delta AMBER | control |
| 450 mL of TB medium | 450 mL of TB medium |
| 450 µl Ampicillin | |
| 80 µl C321A competent cells | 80 µl MG1655 competent cells |
incubate bacteria overnight in this media at 30°C and 180 rpm
cells reached overnight only an OD 600 of 0.34 (C321deltaA) and 0.6 (MG1655)
03.08.2019
set up a new culture (500 ml) in a 2 L flask to provide bacteria with enough oxygen
| C321A delta AMBER | control |
| 450 mL of TB medium | 450 mL of TB medium |
| 450 µl Ampicillin | |
| 80 µl C321A competent cells | 80 µl MG1655 competent cells |
cells have an OD 600 of 2.8 after incubation overnight but already reached the plateau. That is why I will set up a new culture.
05.08.19
set up new cultures with TB and LB
| C321A delta AMBER | control |
| 500 mL of TB medium | 500 mL of TB medium |
| 500 µl Ampicillin | |
| 80 µl C321A competent cells | 80 µl MG1655 competent cells |
| C321A delta AMBER | control |
| 500 mL of LB medium | 500 mL of LB medium |
| 500 µl Ampicillin | |
| 80 µl C321A competent cells | 80 µl MG1655 competent cells |
ODs were measured after 6 hours.
MG1655 strain grown in LB reached an OD 600 of 3.3 after 8 hours.
Bacteria were centrifuged for 15 min at 5000 x g and 4°C
washed 3 times with S30 buffer, transferred to a 2 mL microfuge tube and stored at -80°C
06.08.2019
Strain C321deltaA grown in TB reached an OD of 2.4 after 29 hours.
Cells were centrifuged and washed with S30 as described above (same treatment as for MG1655)
Cells were suspended in 800 µl per 1 g of wet cell mass. In this case it was:
| strain | mass [g] | volume of S30 [µl] |
| MG1655 in TB | 1.32 | 1056 |
| C321deltaA in TB | 1.08 | 864 |
| MG 1655 in LB | 1.53 | 1224 |
1.4 mL was lysed via sonication (3x 6 cycles 30 sec)
centrifugation for 10 minutes at 12000x g and 4°C
supernatant was flash-freezed in liquid nitrogen
set up a 50 mL culture (LB + chloramphenicol) of sfGFP in pBAD
07.08.2019
Performed a Midi-Prep with the QiaGen Kit and the sfGFP culture from yesterday evening
- Harvest overnight bacterial culture by centrifuging at 6000 x g for 15 min at 4°C.
- Resuspend the bacterial pellet in 4 ml Buffer P1.
- Add 4 ml Buffer P2, mix thoroughly by vigorously inverting 4-6 times and incubate at room temperature (15-25°C) for 5 min.
- Add 4 ml prechilled Buffer P3, mix thoroughly by vigorously inverting 4-6 times. Incubate on ice for 15 min.
- Centrifuge at 14000 x g for 10 min at 4°C. Centrifuge at 20000 x g for 30 min at 4 °C.
- Equilibrate a QIAGEN-tip 100 applying 4 ml Buffer QBT, and allow column to empty by gravity flow.
- Apply the supernatant from step 5 to the Qiagen-tip and allow it to enter the resin by gravity flow.
- Wash the QIAGEN-tip with 2 x 10 ml Buffer QC. Allow Buffer QC to move through the Qiagen-tip by gravity flow.
- Elute DNA with 5 ml Buffer QF into a clean 15 ml vessel.
- Precipitate the DNA by adding 3.5 ml roomtemperature isopropanol to the eluted DNA and mix. Centrifuge at 15000 x g for 30 min at 4°C. Carefully decant supernatant.
- Wash the DNA pellet with 2 ml room-temperature 70% ethanol and centrifuge at 15000 x g for 10 min. Carefully decant supernatant.
- Air-dry pellet for 5-10 min and redissolve DNA in a suitable volume of appropriate buffer.
Set up cloning:
We want to have the AMBER66-, Phe66- and AMBER mutation outside the chromophore in a sfGFP behind a AraC promotor to induce it with arabinose. Other mutations are behind light induced promotor and need to be light induced.
Plasmid: sfGFP in pBAD behind AraC promotor
Set up 3 PCRs:
1,5 µl Primer forward (20 µM)
1,5 µl Primer revers (20 µM)
1 µl DNA Template
11 µl bidest. H2O
15 µl Phusion Flash Master Mix
Sample 1: Phe66 mutation
Primer forward: [Phos]TTTGGTGTTCAATGCTTTTCCCG
Primer reverse: [Phos]GGTCAGAGTAGTGACAAGTG
Anneal at 54°C
Sample 2: AMBER66 mutation
Primer forward: [Phos]TTTGGTGTTCAATGCTTTTCCCG
Primer reverse: [Phos] TAGGGTGTTCAATGCTTTTCCCG
Anneal at 54°C
Sample 3: AMBER outside the Chromophore
Primer forward: [5’Phos]TAGTCTGTCCGTGGAGAGGGTGAA
Primer reverse: [5’Phos]TTTGTGCCCATTAACATCACCATCTAATTCAAC
Anneal at 62°C
08.08.2019
Electrophoresis with agarose gel: (continue cloning from yesterday)
Use a 1% agarose gel
mix it with 5 µl Ethidiumbromid
Add 5 µl Gel Loading Dye Purple (6X) to the PCR product
Load the first well of the gel with 5 µl Gene Ruler 1 kb DNA Ladder
Run the gel at 150 mV for 25 minutes
Gel extraction:
Use QIAquick Gel Extraction Kit Protocol
Ligation:
17 µl extracted PRC product
add 2 µl 10X T4 DNA Ligation Buffer
add 1 µl T4 DNA Ligase
incubate over night at 4°C
Set up in vitro expression of sfGFP with cell lysate:
Mix following samples:
| Component | amount [µl] | end concentration |
| ATP (100 mM) | 0.18 | 1.2 mM |
| Plasmid (sfGFP in pBAD behind light inducible promotor) | 5 | 13.3 ng/µl |
| Dtt (1M) | 0.15 | 10 mM |
| RNase inhibitor | 1 | |
| Lysate | 13.17 |
Three different samples were set up with 3 different cell lysates:
1. MG1655 grown in LB
2. MG1655 grown in TB
3. C321deltaA grown in TB
A fourth sample was set up containing MG1655 grown in LB and PURE Kit
| Component | amount [µl] | end concentration |
| RNase inhibitor | 1 | |
| Plasmid | 14 | 13.3 ng/µl |
| Solution A PURE kit | 5 | |
| Solution B PURE kit | 3.5 | |
| Cell lysate MG1655 grown in LB | 13.17 |
Samples were poured into a 96-well plate and incubated at 30°C for 20 h and under 450 nm blue light with intensity 90 for promotor induction.
09.08.2019
DPN1 digestion with ligated PCR product (mutations in sfGFP behind AraC):
Add:
0,5 µl DPN1
incubate for an hour at 37°C
Transformation:
Thaw bacteria on ice (Top 10 competent E. Coli (Ag Di Ventura, BIOSS))
take 50 µl bacteria
add 5 µl DNA
incubate 30 minutes on ice
heat shock at 42°C for 45 seconds
put them back on ice for 2 minutes
(forgot to add 500 µl LB medium)
incubate on shaker at 37°C for 45-60 min (not longer)
start worming plates
plate 100-200 µl bacteria on the plate
incubate at 37°C over night
measurement of in vitro samples from yesterday with the plate reader to see if some sfGFP was expressed
Excitation: 488 nm
Emission: 512 nm
As there was no negative control (cell lysate without plasmid) we can’t tell if the signal (compared to water) is not an autofluorescent signal. Therefore the expression is repeated with the proper negative control.
Set up in vitro expression of sfGFP with cell lysate:
Mix following components for the positive reaction:
| Component | amount [µl] | end concentration |
| ATP (100 mM) | 0.36 | 1.2 mM |
| Plasmid (sfGFP in pBAD behind light inducible promotor) | 16.2 | 13.3 ng/µl |
| Dtt (1M) | 0.3 | 10 mM |
| RNase inhibitor | 1 | |
| Lysate (MG1655 or C321deltaA) | 12.2 |
An additional sample was prepared containing addtionally to all other components 5 µl of solution A and 3.5 µl of soltion B from the PURExpress deltaRF123 Kit
Mix following components for negative control:
| Component | amount [µl] | end concentration |
| ATP (100 mM) | 0.36 | 1.2 mM |
| H2O | 16.2 | 13.3 ng/µl |
| Dtt (1M) | 0.3 | 10 mM |
| RNase inhibitor | 1 | |
| Lysate (MG1655 or C321deltaA) | 12.2 |
Two 96-well plates (black) were loaded:
| H2O | MG1655 | C321deltaA |
| MG1655 + Plasmid | C321deltaA + Plasmid | |
| MG1655 + Plasmid + PURE |
10.08.2019
measurement with the plate reader of 96-well plate light-induced and -uninduced.
Excitation: 488 nm
Emission: 512 nm
Result does not show a specific fluorescence signal in the positive reactions as the signal is stronger in those samples without the plasmid.
12.08.2019
Picking 2 colonies from each plate (Phe66, AMBER66, AoCH) and let it frow in 4 ml LB + Chloramphenicol at 37°C on the shaker for min 6 hours.
Run a gel (12% Tris-glycine Mini Precast) with the cell lysate reactions from yestserday to see if there really is no GFP or if the problem is detection:
Loaded the gel with different amounts of the samples.
| MG1655 | MG1655+Plasmid | MG1655+PURE | C321deltaA | C321deltaA | |||||
| 2.5 µl sample | 5 µl sample | 2.5 µl sample | 5 µl sample | 2.5 µl sample | 5 µl sample | 2.5 µl sample | 5 µl sample | 2.5 µl sample | 5 µl sample |
| 5 µl H2O | 2.5 µl H2O | 5 µl H2O | 2.5 µl H2O | 5 µl H2O | 2.5 µl H2O | 5 µl H2O | 2.5 µl H2O | 5 µl H2O | 2.5 µl H2O |
| 2.5 µl Lämmli Buffer | 2.5 µl Lämmli Buffer | 2.5 µl Lämmli Buffer | 2.5 µl Lämmli Buffer | 2.5 µl Lämmli Buffer | 2.5 µl Lämmli Buffer | 2.5 µl Lämmli Buffer | 2.5 µl Lämmli Buffer | 2.5 µl Lämmli Buffer | 2.5 µl Lämmli Buffer |
Loaded the wells in the gel in following order:
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 |
| Color Protein Standard | MG1655 (2.5 µl) | MG1655 + Plasmid (2.5 µl) | MG1655 + PURE (2.5 µl) | C321deltaA (2.5 µl) | C321deltaA + Plasmid (2.5 µl) | MG1655 (5 µl) | MG1655+Plasmid (5 µl) | MG1655+PURE (5µl) | C321deltaA+Plasmid (5 µl) |
Ran the gel for 30 min at 200 V
Stained the gel with Instant Blue for 1 hour.
Amplification of the sfGFP under pBAD promotor (AraC contained in this plasmid) to run a cell lysate reaction with arabinose induction.
Thaw bacteria on ice (Top 10 competent E. Coli (AG Di Ventura, BIOSS))
take 50 µl bacteria
add 5 µl ligated PCR DNA
incubate 30 minutes on ice
heat shock at 42°C for 45 seconds
put them back on ice for 2 minutes
add 500 µl LB medium (make sure it’s transparent)
incubate on shaker at 37°C for 45-60 min (not longer)
start worming plates (Chloramphenicol plates should be prewarmed for 60 minutes)
plate 100-200 µl bacteria on the plate
incubate at 37°C over night
13.08.2019
Mini prep with Phe66, AMBER66 and AoCH mutations in sfGFP under pBAD promotor (with AraC containing)
one of the two AoCH cultures didn’t show growth, which causes the suggestion that one of the other cultures contains two different cultures, for this reason new colonies of each mutation are picked and grown in 4 ml LB+Chloramphenicol (in case the sequencing results show contamination).
4 colonies were picked from the sfGFP (under pBAD promotor with AraC) and grown in 4 ml LB+Chloramphenicol
Mini Prep with all cultures from this morning (wt-sfGFP, Phe66, A66, AoCh under pBAD with AraC)
A glycerol stock (25% end concentration of glycerol) was set up of each plasmid
--> Mini prep machine destroyed samples with wt-sfGFP and AoCh, therefore a new culture was set up out of the glycerol stocks (4 ml)
14.08.2019
Mini prep with the cultures from yesterday.
Set up a new cell free expression with following amounts:
C321deltaA lysate + Plasmid
| Component | amount [µl] | end concentration |
| H2O | 4.72 | |
| Lysate | 4.05 | 27% |
| RNase Inhibitor | 1 | |
| DNA | 2.7 | 13.3 ng/µl |
| HEPES | 0.85 | 57 mM |
| ATP | 0.18 | 1.2 mM |
| Arabinose | 1.5 | 1% |
C321deltaA lysate without plasmid
| Component | amount [µl] | end concentration |
| H2O | 7.42 | |
| Lysate | 4.05 | 27% |
| RNase Inhibitor | 1 | |
| HEPES | 0.85 | 57 mM |
| ATP | 0.18 | 1.2 mM |
| Arabinose | 1.5 | 1% |
C321deltaA + Plasmid + PURE
| Component | amount [µl] | end concentration |
| Lysate | 4.05 | 27% |
| RNase Inhibitor | 1 | |
| DNA | 2.7 | 13.3 ng/µl |
| HEPES | 0.85 | 57 mM |
| ATP | 0.18 | 1.2 mM |
| Arabinose | 1.5 | 1% |
| Solution A PURE | 5 | |
| Solution B PURE | 3.5 |
C321deltaA without Plasmid + PURE
| Component | amount [µl] | end concentration |
| Lysate | 4.05 | 27% |
| RNase Inhibitor | 1 | |
| H2O | 2.7 | 13.3 ng/µl |
| HEPES | 0.85 | 57 mM |
| ATP | 0.18 | 1.2 mM |
| Arabinose | 1.5 | 1% |
| Solution A PURE | 5 | |
| Solution B PURE | 3.5 |
Incubate the samples at 30°C for 20 hours.
Preparing a new lysate from frozen cells in -80°C:
Thawed cells were suspended in 0.8 ml S30 buffer per 1 g wet cell mass.
1.5 ml were transferred in a 1.5 microtube
Cells were lysed with the Bioruptor Tm new Gen 3 x 8 cycles at high mode
Centrifugation at 12,000 g and 4°C for 10 min.
supernatant was flash-frozen in liquid nitrogen
15.07.2019
Samples with expression were loaded onto a 384-well plate
The plate was measured with the plate reader. Once without a positive control and once with fluorescein as a positive control (100 µg/µl)
16.08.2019
Set up a new reaction:
C321deltaA lysate + Plasmid
| Component | amount [µl] | end concentration |
| H2O | 4.72 | |
| Lysate | 4.05 | 27% |
| RNase Inhibitor | 1 | |
| DNA | 2.7 | 13.3 ng/µl |
| HEPES | 0.85 | 57 mM |
| ATP | 0.18 | 1.2 mM |
| Arabinose | 1.5 | 1% |
C321deltaA lysate without plasmid
| Component | amount [µl] | end concentration |
| H2O | 7.42 | |
| Lysate | 4.05 | 27% |
| RNase Inhibitor | 1 | |
| HEPES | 0.85 | 57 mM |
| ATP | 0.18 | 1.2 mM |
| Arabinose | 1.5 | 1% |
C321deltaA lysate + Plasmid + PURE
| Component | amount [µl] | end concentration |
| Lysate | 4.05 | 27% |
| RNase Inhibitor | 1 | |
| DNA | 2.7 | 13.3 ng/µl |
| H2O | 2.7 | |
| Solution A PURE | 2.1 | |
| Solution B PURE | 2.2 | |
| Arabinose | 1.5 | 1% |
C321deltaA without Plasmid + PURE
| Component | amount [µl] | end concentration |
| Lysate | 4.05 | 27% |
| RNase Inhibitor | 1 | |
| H2O | 5.65 | |
| Solution A PURE | 5 | |
| Solution B PURE | 3.5 | |
| Arabinose | 1.5 | 1% |
Incubate the samples at 30°C for 20 hours. In the dark.
Set up new culture:
500 ml LB medium in a 5 L erlenmeyer flask
100 µl C321deltaA competent cell
Incubate at 30°C and 220 rpm until the culture reaches an OD 600 of 2.5
Set up new S30 Buffer:
Set up Tris acetate:
meassured pH = 8.08
| component | amount | concentration [mM] |
| Trisma base | 30.25 g | 303 |
| Acetic acid (100%) | 10 mL | |
| dd H2O | 90 mL |
Set up a S30 Buffer:
| component | amount | concentration [mM] |
| Tris-acetate pH 8.08 | 33 mL | 10 |
| Magnesium acetate | 2 g | 12 |
| Potassium acetate | 5.89 g | 60 |
| Dithriotheitol (1 M | 2 mL | 2 |
| dd H2O | 965 mL |
Sent clonings to sequencing 10 µl of each AMBER outside of chromophore and AMBER66 and Phe66 in sfGFP under pBAD promotor with AraC (arabinose induction).
Measure a dilution row of fluorescein as calibration for sfGFP measurement in the plate reader
Dilute fluorescein to 10 µM
take 100 µl of it and dilute it with 100 µl 1x PBS as described on iGEM website https://www.protocols.io/view/calibration-protocol-plate-reader-fluorescence-cal-548g8zw?step=19
Reaction and measurment was repeated once (n=2)
