Team:Freiburg/Labbook/Functional Assays
To verify the biological functionality of the peptides we synthethized by SPPS: the MRSA toxin PSMa3 and its ligands that we identified by MIPD or FinDr. For this purpose we performed toxicity assays and analyzed the activation of the FPR2 receptor which we cloned and transfected into HEK293 cells for this purpose. Furthermore we wanted to demostrate the protease resistance of D-proteins, therefore we performed degradation assays using the unspecific endopeptidase proteinase K.
Click on an item for a detailed description
04.07.2019
Cloning of the FPR2-GFP Expression construct:
Plasmids:
FPR2-Tango: contains the FPR2 receptor with a Flag Tag
eGFP: Plasmid with integrated GFP, kozak sequence and Kanamycin resistance
Primer:
| 1 | pEGFP-N1(Clontech) FWD | 5' CGATGATCGATGGAGGATCCATGGTGAGCAAGGGCGAGGA 3' |
| 2 | pEGFP-N1(Clontech) REV | 5' AGGGCGATGATCGTCTTCATGGTGGCGACCGGTGGATCCC 3' |
| 3 | pTango_FPR2 FWD | 5' GGGATCCACCGGTCGCCACCATGAAGACGATCATCGCCCT 3' |
| 4 | pTango_FPR2 REV | 5' TTGCTCACCATGGATCCTCCATCGATCATCGCTTGGAGTT 3' |
FPR2 sequence:
ATGGAAACCAATTTCTCTACTCCCCTGAATGAGTACGAAGAGGTGTCTTACGAATCAGCGGGCTACACAGTCCTGCGAATCCTCCCGCTTGTCGTACTTGGCGTGACTTTTGTGCTCGGTGTTCTTGGTAACGGGTTGGTAATCTGGGTGGCAGGGTTCAGAATGACTCGCACGGTGACTACCATTTGCTACCTCAACCTGGCCCTGGCCGATTTTTCCTTTACTGCTACTCTCCCGTTTCTCATTGTGTCTATGGCCATGGGCGAGAAATGGCCTTTCGGGTGGTTCCTGTGCAAGCTCATCCACATTGTGGTGGACATCAATCTTTTTGGTAGTGTCTTCCTGATAGGCTTTATTGCACTCGATAGGTGTATTTGTGTACTGCACCCAGTCTGGGCCCAGAATCACAGAACCGTCAGCCTTGCTATGAAAGTGATAGTTGGTCCATGGATCTTGGCCCTGGTGCTTACCCTGCCAGTTTTCTTGTTTCTCACCACCGTGACCATCCCAAATGGCGACACATACTGCACATTTAATTTCGCAAGCTGGGGGGGTACGCCTGAGGAGCGATTGAAGGTTGCGATAACCATGTTGACAGCCAGAGGAATAATCAGATTCGTGATTGGCTTCTCCCTGCCGATGTCTATAGTGGCTATCTGCTACGGCCTCATCGCGGCTAAGATCCATAAGAAAGGTATGATCAAGTCTTCCAGGCCTCTCCGGGTATTGACAGCCGTAGTTGCAAGTTTCTTTATATGCTGGTTCCCTTTCCAGCTGGTGGCACTGCTGGGAACTGTGTGGCTGAAAGAAATGTTGTTCTATGGGAAGTATAAAATAATTGACATTCTCGTAAACCCTACCAGCAGTCTGGCTTTTTTTAACTCTTGCCTGAACCCAATGCTGTATGTTTTTGTGGGCCAGGACTTCCGAGAACGGCTGATTCACAGCCTTCCTACCTCACTGGAGAGAGCCCTGAGCGAAGATAGTGCGCCCACGAACGACACCGCCGCCAACTCCGCTTCTCCTCCTGCTGAGACAGAACTCCAAGCGATGATCGAT
Amplification of eGFP with primers 1&2, amplification of FPR2 with primers 3&4 with the following protocol:
19 uL H2O
2.5 uL each primer
1 uL DNA
+ 25 uL Q5 Master Mix from NEB
After succesful amplification of the fragments, gibson assembly was done:
50 ng of Backbone with a 1:3 ratio of DNA to the insert. Equal amount of HiFi Gibson Assembly Master Mix from NEB and 15 minutes incubation at 50°C
Transformation of competent cells:
Thaw competent bacteria (Top10) on ice. Add 2 uL of the gibson assemlby master mix to the bacteria and flick (never vortex).
Incubated on ice for 20-30 minutes (25 is ideal). Then heatshock for 45s at 42°C. Put back on ice for 2 minutes.
Preheated plate at 37°C
Added 500 uL of LB medium without any antibiotics. Put on 37°C shaker for around 55 minutes (never longer than 60!)
Immediately plated ~200 uL on an agar plate with siutable antibiotic.
Left plate for ~18h in the incubator.
Next day: Picked colonies and do a liquid culture for ~6 h. Then miniprep the DNA and sequence.
07.09.2019
Cloning FPR2 with mCherry instead of with sfGFP in order to perform experiments in the context of our collaboration with TU Darmstadt, who have GFP on their Virus-like particles (VLPs).
Ordered Primers to amplify the already cloned plasmid containing FPR2 in eGFP. Also mCherry was amplified out of a plasmid kindly given to us by AG Di Ventura in the faculty of biology in Freiburg.
The primers contain the following sequences (blue is considered the overhang):
| mC1 | eGFP FWD | GCATGGACGAGCTGTACAAGTAAAGCGGCCGCGACTCTAG | |
| mC2 | eGFP REV | GCTGGATCCTCCGGATCCTCCATCGATCATCGCTTGGAGTTC | |
| mC3 | mCherry FWD | ATGGAGGATCCGGAGGATCCAGCATGGTGAGCAAGGGCGAGGAG | |
| mC4 | mCherry REV | GATCTAGAGTCGCGGCCGCTTTACTTGTACAGCTCGTCCATGCC |
PCR protocol:
mC1 + mC2 have a Tm of 72° with Phusion Flash
mC3 + mC4 have a Tm of 68° with Taq Pol (Phusion was empty).
The PCR programme was the following:
Denaturiation: 95°C, 45s
Annealing: 68°C to 72°C gradient PCR, 30s
Elongation: 72°C, 1:20 min
Final extension: 72°C 2:00 min
Loaded PCR products on 1.2% agarose gel and run at 100 V for 1:30h. Visualized bands under UV light:
Made PCR purification of the products after verifying their size on the gel. Assembled the fragments via Gibson Assembly, using the NEB 2x HiFi Gibson Assembly Master Mix for 20 minutes and transformed into top 10 E. coli. Let grow overnight.
11.07.2019
- Thawed cells.
- HEK293T p15 2*106 cells
- Jurkat 10*106 celles
- Medium: RPMI: HEPES 1:1000 and 10% FCS
12.07.2019
- purification of pEGFP bands
→ concentration of 33 ng/μL
15.07.2019
- tired out trypan blue stain with Jurkat cells with and without 50 μL SDS
→ nearly no white cells without SDS
→ NO white cells with SDS
- changed medium of HEK cells
16.07.2019
- dissolved L-PSMα3 (self synthesized by SPPS) in 240 μL H2O → 10 mM → 50 μL aliquots, stored at -20°C
- dissolved D-PSMα3-Lys-PEG4-Biotin (from Genecust) in 7 mL → 1 mM → 1 mL aliquots, stored at -20°C
- dissolved L-PSMα3 (from Genecust) in 767 μL H2O for 20 min, put in ultrasound bath and added 10% (76 μL) DMSO, vortexed, stored at -20°C
- mixed LDH storage buffer (100 mL):
- 200 mM TRIS-HCl pH 7.3
- 10% Glycerol
- 1% BSA
17.06.2019
LDH-Assay test concentrations
- seeded 100.000 Jurkat cells in 500 μL RPMI (without FCS and HEPES) in a 12-well plate
- added 2.5 μL H2O / L-PSMα3 (from Genecust) in concentrations 0.01 μM, 0.1 μM, 2 μM, 4 μM, 8 μM, 16 μM, 50 μM / 50 μL 100x Trition-X 100
- incubated at 37°C for 1h
- centrifuged the cells at 300 g for 3 min
- took 50 μL of each supernatant and added to a white 96 well plate (duplicates), diluted 5 μL of supernatant 1:10 in PBS 1% BSA and added 50 μL each to the plate in seperate wells
- also: 50 μL of LDH substrate as -ctrl undiluted. 1:10, 1:100 (all as duplicates)
- added 50 μL LDH reaction mix (substrate mix + 11.4 mL ultrapure H2O + 0.6 mL assay buffer) to each well in < 1 min.
- incubated for 30 min at RT in the dark
- stopped with 50 μL stopping solution in < 1 min
- transferred 130 μL of each sample to a transparent ELISA plate
- made new LDH controls as before, made a H2O control (50 μL)
- added 50 μL LDH reaction mix to the new controls, incubated for 30 min at RT in the dark
- added 50 μL stopping solution
- measurement of absorption at 490 nm and 680 nm
--> pictures or chart of results
18.07.2019
LDH assay
- seeded 105 Jurkats in 500 μL in a 12 well plate
- added 10 μL H2O each 2 μL or 8 μL of PSMα3 variant --> see workspace?
- incubated at 37°C for 1 h
- centrifuged at 300 g for 3 min
- took 50 μL of each supernatant and added to the white 96 well plate, diluted 5 μL 1:10 in PBS 1% BSA and added 50 μL each to the plate
- added 50 μL LDH reaction mix
- incubated for 30 min at RT in the dark
- stopped with 50 μL stopping solution in < 1 min
- measurement at 490 nm and 680 nm
--> pictures or chart of results
- diluted all synthesized PSMα3 variants and fragments in H2O to a concentration of 1 mM
- D-PSMα3 (SPPS): 590 μL
- L-PSMα3 (SPPS): 460 μL
- Fragment A: 10.4 mL
- Fragment B: 19.7 mL
- Mutant: 2.04 mL
- diluted L-PSMα3 to a concentration fo 10 mM
20.07.2019
- splitted HEK 293 T- cells 1:2 in fresh medium
LDH assay
- seeded 105 Jurkats in 500 μL in a 12 well plate
- added H2O / 50 μL 10x
lysis buffer / dilution range of L-PSMα3 (Genecust)
concentrations 0.1μM → in 0.2μM steps → 1.7μM
2μM → in 0.5μM steps → 4μM
5μM → in 1μM steps → 8μM
10μM, 50μM, 200μM, 800μM
- incubated at 37°C for 1 h
- centrifuged at 300 g for 3 min
- took 50 μL of each supernatant and added to the white 96 well plate, diluted 5 μL 1:10 in PBS 1% BSA and added 50 μL each to the plate
- added 50 μL LDH reaction mix
- incubated for 30 min at RT in the dark
- stopped with 50 μL stopping solution
- centrifuged the plate shortly to remove bubbles
- measurement at 490 nm and 680 nm
23.07.2019
- mixed L-PSMα3 (Genecust) 10 mM (43 μL) and D-PSMα3-Lys-PEG4-Biotin (Genecust) 1 mM (430 μL) with 80 μL H2O to a racemic mixture of 800 μM (each)
- incubated at RT for > 24 h
25.07.2019
- performed LDH assay with
- L-PSMα3 (Genecust): 0.1 μM, 2 μM, 8 μM
- freshly mixed L- and D-PSMα3 (Genecust): 1 μM + 1 μM, 4 μM + 4 μM
- precomplexed L- and D-PSMα3 (Genecust): 2 μM and 8 μM
26.07.2019
- transferred HEK cells to 6- well adhesion plates
05.09.2019
- weighed and dissolved self synthesized ligands from Mirror Image Phage Display in H2O to a final concentration of 10 mM
- F6: #2 surf27: 10 mg + 0.654 mL
- F7: #2 ctrl2: 12.8 mg + 0.938 mL
- F1: #1 sol9: 9 mg + 0.569 mL
- F2: #2 surf8: 10 mg +0.691 mL
- F1: #2 surf 11: 11.2 mg + 0.757 mL
- F1: #2 sol17: ~5 mg + 0.326 mL
- made C1: 1 mM and C2: 100 μM of all ligands
06.09.2019
- diluted D-PSMα3 (Genecust) in 1510 μL H2O → 5 mM, 200 μL aliquots
LDH assay
- prepared plated with dilutions of ligands --> extra sheet?
- seeded 105 Jurkats in 500 μL RPMI, 10% FCS, 0.1% HEPES
- preincubated ligands with D-PSMα3 in RPMI for about 5 min
- 1 mM of al ligands turned the red medium colorless, less for #2 sol17 not for 50 μM and less
- incubated for 1 h at 37°C
- added 50 μL reaction buffer, incubated for 30 min
- added 50 μL stopping solution
08.09.2019
- all cells contaminated
- changed the medium
- cleaned everything
- autoclaved everything
- decontamination program of incubator
10.09.2019
- got new Jurkats (from Vincent)
- made two 10 cm dishes
LDH assay
- took 105 Jurkats
- with D-PSMα3 with the dilutions from last time
→ RPMI medium of dilutions was contaminated
- cast a 16-20% gradient gel + 10% stacking
Proteinase K digestion
loading plan: ladder, prot K, only L, L-1h, L-24h, only D, D-1h, D-24h, only BSA, BSA-1h, BSA-24h
- ran gels at 0.02 mA
- developed without fixation with silver stain
LDH assay was repeated with new medium
11.09.2019
LDH assay
- L-PSMα3 (4 μM)
- tested RPMI with and without serum and different cell concentrations
Proteinase K digestion
- same concentrations as before
16.09.2019
- cells contaminated again, only thing that wasn't changed or decontaminated were laminin coated cell culture dishes and HEPES
→ discarded all cells, cleaned everything, decontamination of incubator wasn't necessary
→ new HEPES and add Penstrep next time
04.10.2019
- Performed LDH assay with newly synthethised ligands (L-form, round1) 200 μM ligand concentration, 4 μM D-PSMα3, 105 Jurkat cells in 0.5 mL per sample.
Due to the low detectable toxicity of D-PSMa3 as compared to the lysis buffer we assume that the number of cells was too low to detect differences in toxicity due to the ligands. See repetition later.
09.10.2019
Performed LDH assay using 20 μM of L-ligands and 2 μM of D-PSMa3 in 500 μL RPMI containing 2*105 Jurkat T-cells.
Measured absorbance of GA2 with Reaction buffer without cells.
14.10.2019
LDH assay as before.
19.10.2019
LDH assay as before
31.07.2019
- coupeled Alexa Fluor 647 to a mouse anti human FPR2 antibody (Aldevron GM1D6) using a Moleculare Probes Antibody labeling kit
- diluted anti-FPR2-AlexaFluor647 from a concentration of 2 mg/mL to 1 mg/mL in PBS
01.08.2019
FACS analysis of FPR2 expression on Jurkat cells using FACS Gallios:
Jurkat in 200 μL FACS buffer (0.5 % BSA in PBS)
- unstained
- 1:50 anti FPR2 - Alexa Fluor 647
- 1:100 anti FPR2 - Alexa Fluor 647
14.08.2019
- dissolved the FPR2-activator WKYMVm (Cat #: GPW-105, Alomone Labs) (stock: 100 μM → 5.84 mL in 1 mL aliquots)
Ca2+ flux measurement
- centrifuged cells at 300 g for 3 min, added 300 μL new media (1% FCS) and putn on ice
- added 75 μL cells to 1.4 mL 1% FCS media and warmed to 37°C
- measured: 2:10 min baselife added stimulus ( final concentration of)
- 100 nM and 1 μM WKYMVm
- 70 nM and 700 nM L-PSMα3 (Genecust)
- 1 μg/mL ionomycine
in 40 μL PBS, concentration for 1.5 mL final measuring sample
MACS Quant measurement:
2 min measurement of baseline, at timepoint 2 min addition of stimulus, at timepoint 5 min 30 s addition of ionomycine as positive control (ionomycine only for samples 100 nM WKYMVm and 700 nM L-PSMα3)
20.08.2019
- Miniprep of FPR2 (concentration 969.8 ng/μL → 0.9698 ng/μL)
- preincubated HEKs with fresh medium for 1 h
- transfection of HEKs:
- added 5 μg/1 μg DNA and 30 μL PEI (1 mg/mL) to 520 μL RPMI in a 15 mL centrifuge tube
- vortexed quickly
- let sit at RT for 10 min
- added the solution dropwise to plate of HEKs, gently swirling
- incubate for 24 h at 37°C, 5% CO2
21.08.2019
- changed medium of transfected cells
22.08.2019
- took pictures of transfected cells and harvested 2 mL of suspended HEKs for FACS analysis (FPR2/microscope_pictures_transfection/0822_transfection_HEK_fpr2/hek%201ug.jpg) and others in this folder
FACS measurement
- centrifuged at 300 g for 3 min
- diluted cells in 400 μL FACS buffer each and added 200 μL of each (untransfected, 1 μg and 5 μg transfected) to a FACS tube --> FACS Results?
- stained for 20 min
27.08.2019
- preincubated HEKs with fresh medium for 2 h
- transfection of HEK 293s:
- 520 μL RPMI in a falcon added 5 μg/1 μg DNA and 30 μL PEI (1 mg/mL)
- vortexed quickly
- let sit at RT for 10 min
- add solution dropwise to plate of HEKs, gently swirling
- incubate for 24 h at 37°C, 5% CO2
29.08.2019
- new medium for transfected cells FPR2/microscope_pictures_transfection/0829_transfection_HEK_FPR2/hekuntransfneu2.jpg and others in this folder
- cast gradient gels (10-15% and 15-20%)
- cast two 20% urea (3 M) gels (used stacking gel recipe as before)
Ca2+ flux measurement
- baseline, after 2 min added 70 nM L-PSMα3, after another 2 min added 700 nM L-PSMα3, after 8 min 18 s added indo --> Data!
02.08.2019
- mixed APS solution, 30 mg/mL in H2O, stored at 4°C
03.08.2019
cast 16% SDS gel
sperating gel:
- 1.6 mL H2O,
- 2 mL1.5 M TRIS pH 8.8
- 4.27 mL Acrylamide (30%)
- 80 μL 10% SDS .
- 80 μL APS ,
- 8 μL TEMED
- 6 M Urea (2.88 g)
→ 8 mL
stacking gel:
- 2.6 mL H2O
- 1.25 mL TRIS pH 6.8
- 1 mL Acrylamid
- 50 μL APS
- 5 μL TEMED
→ 5 mL
Proteinase K digestion
- D-PSMα3 (SPPS without formylation with biotin) 1000 μM
→ 180 μL + 162 μL TRIS-HCL pH 7.5 + 1 μL proteinase K
- L-PSMα3 (Genecust with formylation, without biotin) 10 mM
→ 1.8 μL + 178.2 μL TRIS-HCL pH 7.5 + 1 μL proteinase K
- incubated at 37°C
- inhibited proteinase K(Endopeptidase K from Tritirachium album provided by Jena Bioscience, 29,8 kDa) after 1 h and 24 h with PMSF for 2 min and denatured it afterwards for 5 min at 95°C
- positive control: 0.2 mg/mL BSA (9 μL 5 mg/mL BSA in NaHCO3 + 170 μL TRIS-HCL pH 7.5 + 1 μL proteinase K)
GEL loading plan:
Ladder ( Thermo Scientific™ Spectra™ Multicolor Low Range Protein Ladder cat.nr 26628) , only prot K, only L-PSMa3, L-PSMa3 + 1h prot K, L-PSMa3 + 24h prot K, only D-PSMa3, D-PSMa3 + 1h Prot K, D-PSMa3 + 24h prot K, only BSA, BSA+ 24h Prot K
--> add gel pics
- made PSMF aliquots:
174 mg + 10 mL EtOH → 100 mM (17.4 mg/mL) stock, stored at -20°C
04.08.2019
- cast two new gels as before and one with 6M urea in the separating gel
- took 24 h samples of proteinase K digestion, added 2 μL PMSF, incubated for 3 min and denatured it for 5 min at 95°C, stored at -20°C
12.08.2019
20 μL sample, 7 μL ladder
- ran nupage gel (4-12%) at 80 V
- fixed gel with 50% methanol 10% aceticacid (glacial) in H2O for 1 h
- stained in 0.1% comassie brilliant blue in a solution with 50% methanol, 10% acetic acid for 20 min at ~30 rpm (big shaker)
- destained in 40% methanol, 10% aceticacid o/n
→ L- and D-PSMα3 without proteinase K, proteinase K only, not denatured at 95°C
13.08.2019
- no more small bands visible
- stained again for 20 min
- destained →no bands visible during the whole process
→ silver stain kit pierce followed manufacturers protocol starting from step 3, but without the filtration step
14.08.2019
- cast two 6M urea 10% gels as before but with 80 μL APS + 8 μL TEMED for stocking and 100 μL APS + 10 μL TEMED for seperation
- dissolved the FPR2-activator WKYMVm (Cat #: GPW-105, Alomone Labs) (stock: 100 μM → 5.84 mL in 1 mL aliquots)
Ca2+ flux measurement
- prestained 7*106 Jurkat cells in 600 μL RPMI + 10% FCS with 3 μL pluronic acid and 2.4 μL Indo1 at 37°C for 30 min
- centrifuged cells at 300 g for 3 min, added 300 μL new media (1% FCS) and putn on ice
- added 75 μL cells to 1.4 mL 1% FCS media and warmed to 37°C
- measured: 2:10 min baselife added stimulus ( final concentration of)
- 100 nM and 1 μM WKYMVm
- 70 nM and 700 nM L-PSMα3 (Genecust)
- 1 μg/mL ionomycine
in 40 μL PBS, concentration for 1.5 mL final measuring sample
MACS Quant measurement:
2 min measurement of baseline, at timepoint 2 min addition of stimulus, at timepoint 5 min 30 s addition of ionomycine as positive control (ionomycine only for samples 100 nM WKYMVm and 700 nM L-PSMα3)
Proteinase K assay:
- loaded gels and ran at 80 V in SDS running buffer
- did a coomassie stain for 20 min
- destained several times, then for 4 h continuously
- silver-stained according to protocol
Gel A:
Gel B:
15.08.2019
Retransformation of Top 10 with FPR2-EGFP (46.7 ng/μL → 4.67 ng/μL)
- added 9.34 ng DNA to 50 μL Top 10 after preincubating both on ice.
- incubated for 10 min on ice
- heatshocked for 90 s at 42°C
- put for 5 min on ice
- added 300 μL LB adn put on heatblock at 37°C, 57 rpm for 1 h.
16.08.2019
Proteinase K digestion in 180 μL PBS:
- 0.26 mg/mL L- and D-PSMα3 (SPPS non-formylated) + 2 μL proteinase K
- 0.2 mg/mL BSA + 2 μL proteinase K
- only PBS + 2 μL proteinase K
- only PBS
- incubated at 37°C
- inhibited proteinase K after 1 h and 24 h with 2 μL PMSF for 2 min and denatured it afterwards for 5 min at 92°C
- casted two 16% 3 MUrea SDS gels
- retransformed bacteria NEB 5α
17.08.2019
ran gels at 80 V:
loading plan:
A: empty, ladder, prot K, D-1h, D-24h, L-1h, L-24h
B: BSA-1h, BSA-24h, ladder, empty
--> gel pics
19.08.2019
- silver stained gels
- picked a clone from FPR2-GFP retransformation and inoculated in LB, incubated o/n
30.08.2019
- ran gels at 0.02 mA and later at 0.04 mA
- developed without fixation with silver stain
loading plan: ladder, prot K, only L, L-1h, L-24h, only D, D-1h, D-24h, only BSA, BSA-24h
10-20% gel No.1:
10-20% gel No.2:
15-20% gel:
20% 3M urea:
10.09.2019
- cast a 16-20% gradient gel + 10% stacking
Proteinase K digestion
loading plan: ladder, prot K, only L, L-1h, L-24h, only D, D-1h, D-24h, only BSA, BSA-1h, BSA-24h
- ran gels at 0.02 mA
- developed without fixation with silver stain
LDH assay was repeated with new medium
11.09.2019
LDH assay
- L-PSMα3 (4 μM)
- tested RPMI with and without serum and different cell concentrations
Proteinase K digestion
- same concentrations as before
16.09.2019
- cells contaminated again, only thing that wasn't changed or decontaminated were laminin coated cell culture dishes and HEPES
→ discarded all cells, cleaned everything, decontamination of incubator wasn't necessary
→ new HEPES and add Penstrep next time
Proteinase K digestion
cast gels:
- two gels with 16-20%
- one gel with 18%
- stacking with 16%
17.09.2019
- Proteinase K digestion: ran gel at 110 V silver stain development failed
02.10.2019
- Started Proteinase K digestion as before with PSMa3 and IZN17
03.10.2019
- stopped 24 h Proteinase K digestion, added Laemmli and denatured again for 1 min at 95°C
- ran 12% SDS at 90 V gel with 20uL sample loaded
05.09.2019
- prepared for OctedRED measurement:
in a black 96-well plate the following dilutions of PSMalpha3 and the lingands were prepared.
Measurement:
08.10.2019
Measured ligands MIPD 8.11.27 and unsafe folder 1, safe folder 1, GA1, GA 2 using the OctettRed.
Baseline, D-PSMa3 loading, baseline, ligand association, ligand dissociation.
200 μL PBS, 50 μg/mL BSA in each well. ligand concentration 50 μM, loading concentration PSMa3 50 μg / mL.
Sensor A2: MIPD ligand 8
Sensor B2: MIPD ligand 11
Sensor C2: MIPD ligand 27
Sensor D2: GA 1
Sensor E2: GA2
Sensor F2: safefolder 1
Sensor H2 water negative control
Result Zoom on ligand association:
Result Zoom on ligand association:
