Team:Freiburg/Labbook/D-amino acid oxidase
Click on an item for a detailed description
19.09.2019
Gibson Assembly with DAO insert and pet302 Backbone:
Set up a PCR to amplify the backbone with:
Primer fwd (Nr.14) : GCACGCGAGTCAAAATTATAGGTATAATCGGATCCGG
Primer rev (Nr.15) : CCCGGAACCGGAACCGTGATGATGATGATGATGC
Phusion Flash Enzyme Master Mix
Anneal at 57°C
Run a 1% agarose gel with 1 kb ladder at 120 mV
Perform a gel extraction with QIAGEN Gel extraction kit.
22.09.2019
Set up a Gibson assembly:
6.52 µl Water
1.38 µL Backbone pET302 (PCR amplification)
2.1 µL Insert DAO (gBlock IDT)
10 µL HiFi Assembly Master Mix
Incubate for 15 min at 50°C
DPN1 digest:
add 1 µL DPN1 to the sample and incubate it for 1 hour at 37°C
Perform a transformation and plate the cells on an Ampicillin agar plate.
Incubate overnight at 37°C
Result: No colonies
Reason: Insert needs to be amplificated to get overhangs
23.09.19
Set up a PCR to amplify the inset (DAO):
Primer fwd (Nr.16): GGTTCCGGTTCCGGGATGCACTCGAAGCGC
Primer rev (Nr. 17): CTTGGAACGTGCAGC
Phusion Flash Enzyme Master Mix
Anneal at 58°C
Run a 1% agarose gel with 1 kb ladder at 120 mV
Carry out a gel extraction with QIAGEN gel extraction kit
Result: No PCR product
PCR was repeated with 3% DMSO
Result: No PCR product
Reason: wrong primers were ordered. Primers do not align with the DAO gBlock
Order new Gibson primers with an overhang on both sides for the backbone so that the gBlock does not need to be amplified.
26.09.2019
Set up a PCR amplification for backbone pET302 with primers 18 and 19.
Anneal at 62°C
Run an 1% agarose gel at 120 mV.
Perform a gel extraction with QIAGEN Gel Extraction Kit.
Measured pET302 concentration: 5 ng/µl
Assemble a Gibson reaction with:
Insert: DAO 29 ng
Vector: 50 ng
ddH2O: 7.1 µl
HiFi 2x Master Mix: 20 µl
Incubate for 20 min at 50°C
Perform a DPN1 digest by adding 1 µl DNP1 and incubating for 1 hour at 37°C.
Perform a transformation with TOP10 competent cells.
Plate 100 µl on an agar plate with ampicillin and incubate for at least 6 hours.
Result: No colony growth. Repeat the cloning and try to get higher concentrations of the backbone by decreasing the annealing temperature.
28.09.2019
Set up a PCR amplification for backbone pET302 with primers 18 and 19.
Anneal at 61°C
Run an 1% agarose gel at 120 mV.
Perform a gel extraction with QIAGEN Gel Extraction Kit.
Measured pET302 concentration: 51.4 ng/µl
Assemble a Gibson reaction with:
Insert: DAO 57.98 ng
Vector: 100 ng
ddH2O: 2.25 µl
HiFi 2x Master Mix: 10 µl
Incubate for 20 min at 50°C
Perform a DPN1 digest by adding 1 µl DNP1 and incubating for 1 hour at 37°C.
Perform a transformation with TOP10 competent cells.
Plate 100 µl on an agar plate with ampicillin and incubate for at least 6 hours.
Result: No colonies
30.09.2019
Set up a new PCR for the amplification of the backbone to check if the backbone is the reason for the failure of the Gibson Assembly
Sample 1:
0.96 µl pET302 DNA template (10 ng)
0.75 µl Primers 18 and 19 (0.5 mM)
12.5 µl H2O
Sample 2:
0.96 µl pET302 DNA template (10 ng)
0.75 µl Primers 18 and 19 (0.5 mM)
1.5 µl DMSO (5%)
11 µl H2O
PCR set-up:
Initial Denaturation: 96°C for 1 minutes
Denaturation: 96°C for 30 seconds
Annealing: 61°C for 30 seconds
Elongation: 72°C for 2 minutes
Ending: 72°C for 3 minutes
Hold at 4°C
30 cycles
Run an 1% agarose gel at 120 mV with a 1 kb ladder:
Cut out the bands and perform a gel extraction with QIAGEN Gel Extraction Kit.
pET302 concentration from PCR without DMSO:
pET302 concentration from PCR with DMSO:
Assemble Gibson assemblies:
- Ratio backbone:insert = 1:1 with PCR product containing DMSO
2 µl (100 ng) backbone
2 µl (20 ng) insert (DAO gBlock)
4 µl 2xHiFi Master-Mix - Ratio backbone:insert = 3:1 with PCR product containing DMSO
3 µl (100 ng) backbone
2 µl (58 ng) insert (DAO gBlock)
5 µl 2x HiFi Master-Mix - Ratio backbone:insert = 1:1 with PCR product containing no DMSO
2 µl (100 ng) backbone
2 µl (20 ng) insert (DAO gBlock)
4 µl 2xHiFi Master-Mix - Ratio backbone:insert = 1:1 with PCR product from 28.9.2019
2 µl (100 ng) backbone
2 µl (20 ng) insert (DAO gBlock)
4 µl 2xHiFi Master-Mix
Incubate for 15 minutes at 50°C.
Perform a DNP1 digest by adding 1 µl DPN1 enzyme and incubating for 1 hour at 37°C.
Transform Top10 competent cells with 5 µl of each Gibson product and additionally with 5 µl from the Gibson product from 28.09.19.
Plate 100 µl of each transformation on an agar plate with ampicillin.
Incubate overnight at 37°C.
Plates:
- DAO+pET302 transformation with Gibson product from 28.09.19
- DAO+pET302 Gibson and transformation with PCR product from 28.09.19
- DAO+pET302 1:1 ratio with PCR with DMSO
- DAO+pET302 3:1 ratio with PCR with DMSO
- DAO+pET302 1:1 ratio with PCR without DMSO
Result: Colonies on all plates, except plate 3.
01.10.2019
Pick one colony from plates 1, 2, 4 and 5.
Grow a culture of each colony in LB+Ampicillin at 37°C.
Perform a Miniprep from all culture and send samples to Eurofins for sequencing.
Result: Plasmid not present in all samples.
Do a test digest!
04.10.2019
Pick four colonies of each plate (16 colonies in total) and grow overnight a culture of each in LB + Ampicillin.
Nomenclature:
1a-d) DAO-pET302 Gibson 3:1; PCR with DMSO
2a-d) DAO-pET302 Gibson 1:1
3a-d) DAO-pET302 Gibson (from 28.09.2019)
4a-d) DAO-pET302 Gibson (transformation from 30.09.2019)
Perform a Miniprep 12 hours later.
Perform a test digest with Kpn1-HF and Pst1-HF.
Assemble:
3 µl DNA of each sample
2.5 µl CutSmart Buffer
0.25 µl Kpn1-Hf
0.25 µl Pst1-HF
19 µl H2O
Assemble a negative control of each sample:
3 µl DNA
22 µl H2O
Incubate them at 37°C for 1 hour.
Run an 1% agarose gel.
Fragments of 1.5 and 5.3 kb length are expected.
| 1 kb ladder | 3a control | 3a | 3b control | 3b | 4a control | 4a | 4b control | 4b |
| 1 kb ladder | 3c control | 3c | 3d control | 3d | 4c control | 4c | 4d control | 4d |
The lower part of the gel contains samples 3c, 3d, 4c and 4d together with their controls. As the running properties of these samples compared to their control show a bigger difference, they were sent to sequencing. It is possible that the smaller fragment went out of the gel as the gel was run for too long.
Sequencing results showed that 3c,3d,4c and 4d transformations worked.
08.10.2019
Perform transformation with 3c, 3d, 4c, 4d.
Plate 100 µl on plates with Ampicillin. Incubate them overnight at 37°C in the incubator.
Result: Blasting the sequencing results showed that all colonies had the wrong insert. Instead of D-amino acid oxidase there was a dehydrogenase inserted. This gave reason to suggest that the gBlock was wrong. Therefore a new gBlock was ordered.
16.10.2019
Set up a new PCR for the amplification of the backbone:
1 µl pET302 DNA template
1.5 µl Primers 18 and 19 (1 mM)
11 µl H2O
15 µl Phusion Flash Master Mix
PCR set-up:
Initial Denaturation: 96°C for 1 minutes
Denaturation: 96°C for 30 seconds
Annealing: 61°C for 30 seconds
Elongation: 72°C for 2 minutes
Ending: 72°C for 3 minutes
Hold at 4°C
30 cycles
Run an 1% agarose gel at 120 mV with a 1 kb ladder
Cut out the band and perform a gel extraction with QIAGEN Gel Extraction Kit.
Perform a Gibson assembly with the gBlock D-amino acid oxidase insert and the pET302 backbone:
Ratio backbone:insert = 3:1 with PCR product containing DMSO
4.6 µl (100 ng) backbone
5.8 µl (58 ng) insert (DAO gBlock)
10 µl 2xHiFi Master-Mix
Incubate at 50°C for 25 minutes.
Add 1µl DPN1 for template digestion and incubate 1 hour at 37°C.
Perform a transformation with 5 µl of the Gibson product in 50 µl Top10 competent cells.
Plate 100 µl on an agar plate with ampicillin and incubate overnight at 37°C.
Result: No colonies
Reason: wrong primers with wrong overlap
