Team:Freiburg/Labbook/Aspartate Racemase
Click on an item for a detailed description
23.09.2019
PCR of the pBAD backbone (amplification with overhangs)
Gibbson assembly of pBAD backbone and gBlock rac
sequence aspartate racemase:
CACCATCACCATCACCATCACCATCACCATGGTAGCGGTATGAAAACGATAGGTATACTTGGTGGTATGGGTCCGTTAGCTACGGCCGAACTCTTCAGGAGAATTGTCATTAAAACCCCGGCAAAGAGGGATCAGGAACACCCGAAGGTTATAATATTCAATAATCCTCAAATTCCTGATAGAACTGCTTATATTCTTGGTAAAGGAGAAGATCCAAGACCACAACTTATCTGGACGGCTAAAAGACTAGAAGAGTGTGGGGCCGACTTTATAATAATGCCTTGTAACACCGCGCATGCGTTTGTTGAGGATATAAGGAAGGCTATCAAGATCCCCATAATTAGCATGATAGAAGAAACTGCAAAAAAAGTAAAAGAGTTAGGGTTCAAAAAAGCTGGCTTGCTAGCTACTACTGGAACTATAGTGAGTGGAGTTTATGAAAAAGAGTTTTCCAAGTATGGAGTTGAAATCATGACTCCAACGGAAGATGAGCAGAAAGATGTTATGAGAGGGATATATGAGGGGGTTAAAGCCGGGAATTTGAAGCTTGGAAGAGAGCTACTACTTAAGACTGCAAAAATCCTAGAGGAGAGAGGAGCAGAGTGCATAATAGCTGGATGTACCGAAGTTAGTGTAGTTCTTAAGCAGGATGATCTAAAAGTTCCCCTCATAGATCCTATGGATGTTATAGCAGAAGTTGCCGTTAAGGTTGCATTAGAAAAGTAA
Transformation with competent cells (Top 10)
Plated transformed cells and incubated at 37°C
24.09.2019
inoculated cells in LB + Chloramp. and incubated at 37°C for 8 h
→ nothing grew, put plates with transformed cells again in the incubator
25.09.2019
plates were covered with colonies
picked for colonies, incubated them at 37°C for 8 h
did a miniprep and send them for sequencing
26.09.2019
got the sequencing results → cloning worked
did a transformation of the plasmid with the right sequence and plated it
27.09.2019
inoculated a colony form the new transformation in 20 mL LB + Chloramp., incubated at 30°C o/n
28.09.2019
- added 19 ml to 1 L LB + Chloramp. and induced with 0.2% arabinose when the culture had OD600 0.5
- added 1 ml to 20 mL LB + Chloramp. uninduced as negative control
- incubated both at 18°C o/n (21 h)
29.09.2019
- pelleted cells from both cultures at 16,000 rpm for 10 min at 4°C, discarded supernatant and stored at -80°C
- OD600 3.9 uninduced culture, OD600 3.1 induced culture
- took 32.3 μL of both cultures (with OD600 3.1) and pelleted cells, discarded supernatant and added 10 μL 5x Lämmli buffer, denatured at 96°C for 15 min
- ran SDS-Gel at 100 V
- stained with coomassie blue
loading plan: ladder, 8μL unind, 8μL ind, 2μL unind, 2 μL ind,
30.09.2019
- ran a new gel with different pellet concentration
- loading plan: ladder, 32ul unind, 32ul ind, 100 ul unind, 100 ul ind, 300 ul unind, 300 ul ind
inoculated new 4 mL cultures in TB, LB and M9 minimal medium, incubated at 37°C o/n
01.10.2019
- diluted cultures to OD600 0.1, let grow at 37°C until OD600 0.5 induced half of each medium with 0.2% Arabinose. Let shake for 3 h 30 min at 37°C, 200 rpm.
- ran a SDS gel at 100 V for 1 h 30 min
loading plan: ladder, ladder, LB uninduced, LB induced, M9 uninduced, M9 induced, TB uninduced, TB induced
02.10.2019
- inoculated new 100 mL cultures in LB + Chloramp
03.10.2019
- diluted cultures to OD600 0.1 in L LB + Chloramp, let grow at 37°C until OD600 0.5 induced with 0.1% Arabinose. Let shake for 3 h at 37°C, 200 rpm.
- pelleted cells at 4,000 g, 10 min. Stored at -20°C
- cast a 12 % SDS gel
- ran the SDS gel, coomassie stained gel→ didn't work
04.10.2019
- resuspended cell pellet in 2 ml lysisbuffer per 0.8 gram, incubated 30 min on ice
- sonicated for 5 min, 30 s intervals
- centrifuged at 4,000 g for 15 min, transferred supernatant to a new falcon. Stored at -20°C, discarded pellet.
- purified the protein via his tag purification
→ to low concentration
- inoculated new 4 mL cultures in LB + Chloramp. incubated at 37°C o/n
05.10.2019
- diluted cultures to OD600 0.1, let grow at 37°C until OD600 0.5 induced with 0.1% and 0.2% Arabinose. Let shake at 37°C for 3 h and 6 h and at 18°C for o/n.
- pelleted cells at 4,000 g for 10 min
- ran a SDS gel
- blocked gel with 5% milk o/n
--> picture
06.10.2019
- ran SDS gel for westernblot
- blottet gel onto membrane
- blocked with 5% milk o/n at 4°C
07.10.2019
- washed membrane 3 times with 0.1% TBST
- incubated membrane with His-antibody for 4 h at 4°C.
- washed membrane 3 times with 0.1% TBST
- incubated with secondary anti-mouse antibody for 1 h at 4°C.
loadingplan: 0.1% 3h 6h 9h ladder 0.2% arabinose 3h 6h 9h
08.10.2019
- inoculated new 4 mL cultures in LB + Chloramp. incubated at 37°C o/n
09.10.2019
- diluted cultures to OD600 0.1, let grow at 37°C until OD600 0.5 induced with 0.1% and 0.2% Arabinose. Let shake at 37°C for 3 h and at 30°C o/n.
10.10.2019
- pelleted cells at 16,000 rpm
- added 1 mL lysis buffer and incubated for 30 min on ice
- sonicated cells for 5 x 30 s on ice
- pelleted cells again at 21,000 rpm, transferred supernatant to a fresh tube and resuspended pellet again in 1 mL lysis buffer. Stored at -20°C.
- ran SDS gel
-stained with instant blue
- inoculated new culture, incubated 37°C o/n
11.10.2019
- o/n culture didn't grow due to additional Kanamycin in the medium
- inoculated a new culture in 100 mL LB + Chloramp., incubated o/n
12.10.2019
- diluted cultures to OD600 0.1 in 1 L culture, let grow at 37°C until OD600 0.5 induced with 0.5% Arabinose. Let shake at 37°C for 3 h.
- pelleted cells at 4.000 g for 15 min. Discarded supernatant. Stored pellet at -20°C.
13.10.2019
- washed cells with PBS
- added 5 mL lyses buffer and sonicated for 20 min 5x 30 s on ice
- purified racemase via his-tag purification
--> Added 0.5 g of resin to the column. Added 1 mL lysis buffer and incubated for 10 min.
- Added 5 mL lysate and incubated for 5 min.
- let flow through gravitation.
- washed twice with 5 mL wash buffer. Let flow through gravitation.
- eluted 3 times with 1 mL elution buffer. Let flow through gravitation.
- took samples after each step and denaturated at 96°C for 10 min
- run a SDS gel
- stained with instant blue
