Line 36: | Line 36: | ||
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Contribution">Contribution</a></div></li> | <li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Contribution">Contribution</a></div></li> | ||
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Results">Results</a></div></li> | <li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Results">Results</a></div></li> | ||
− | |||
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Model">Model</a></div></li> | <li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Model">Model</a></div></li> | ||
</ul> | </ul> |
Revision as of 14:22, 21 October 2019
Basic Parts
Genes involved in Aerobactin biosynthesis
Aerobactin is an iron chelator (siderophore) produced by different strains of E. coli. It is a virulence factor enabling E. coli to sequester iron in iron-poor environments and helps bacteria in colonization inside the host. Aerobactin producing operon is a part of ColV plasmid of E. coli strains. Five genes are present on Aerobactin producing operon, four of them (iucA, iucB, iucC, iucD) are involved in Aerobactin synthesis and one (iutA) is responsible for transportation of Aerobactin.
Part name | Part type | Part function |
---|---|---|
BBa_K3011001 | Basic | iucA, involve in Aerobactin biosynthesis in E. coli strains. |
BBa_K3011002 | Basic | iucB, involve in Aerobactin biosynthesis in E. coli strains. |
BBa_K3011003 | Basic | iucC, involve in Aerobactin biosynthesis in E. coli strains. |
BBa_K3011004 | Basic | iucD, involve in Aerobactin biosynthesis in E. coli strains. |
BBa_K3011005 | Basic | iutA, involve in Aerobactin transportation in E. coli strains. It is ferric-aerobactin receptor. |
Metal Ion Chelator
We have used the cytoplasmic domain of Human Copper transporter as a divalent ion chelator. This is to be used as an analogue for the Aerobactin gene for all the experimental purposes in the project. It is known that this protein has the capability to chelate a variety of divalent ion.
Part Number | Part type | Part Function |
---|---|---|
BBa_K3011012 | Basic | Metal Ion chelator |
NsrR binding site
NsrR is a nitric oxide (NO) sensitive transcriptional repressor. In absence of NO it binds to a particular DNA sequence as a homodimer and block transcription. In presence of NO, NsrR binds to NO using Fe-S cluster, due to this NsrR can’t bind to DNA.
23bp NsrR binding site is basically a 11bp inverted repeat with a spacing of 1bp.
Different Promoters | NsrR binding sites |
---|---|
ytfE | aagatgcatttaaaatacatctt |
hmp | aagatgcatttgagatacatcaa |
hmp-2 | aagaaccatttacattgcagggc |
ygbA | aagatgtaatataaatacatctt |
ygbA-2 | aagatgctgttttgcagcttttg |
hcp | aacatgtatattaaatataactt |
hcp-2 | aagttgcatgaaaaatccctttt |
Part name | Part type | Part function |
---|---|---|
BBa_K3011006 | Basic | NsrR binding site. |
References
- DNA Sequence of a ColV Plasmid and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Escherichia coli Strains. DOI: 10.1128/JB.188.2.745-758.2006
- NsrR targets in the Escherichia coli genome - new insights into DNA sequence requirements for binding and a role for NsrR in the regulation of motility. DOI: 10.1111/j.1365-2958.2009.06799.x
- Escherichia coli A2363 plasmid pAPEC-O2-ColV, complete sequence