Team:IISER Kolkata/Basic Part

• Home
• Team
  • Members
  • Guides
  • Collaborations
  • Attributions
• Project
  • Description
  • Design
  • Experiments
  • Notebook
  • Contribution
  • Results
  • Model
• Parts
  • Overview
  • Basic
  • Composite
  • Collection
• Safety
• Humanity
  • Overview
  • Integrated HP
  • Engagement
  • Social

Basic Parts

Genes involved in Aerobactin biosynthesis

Aerobactin is an iron chelator (siderophore) produced by different strains of E. coli. It is a virulence factor enabling E. coli to sequester iron in iron-poor environments and helps bacteria in colonization inside the host. Aerobactin producing operon is a part of ColV plasmid of E. coli strains. Five genes are present on Aerobactin producing operon, four of them (iucA, iucB, iucC, iucD) are involved in Aerobactin synthesis and one (iutA) is responsible for transportation of Aerobactin.

Aerobactin Production

Part name	Part type	Part function
BBa_K3011001	Basic	iucA, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011002	Basic	iucB, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011003	Basic	iucC, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011004	Basic	iucD, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011005	Basic	iutA, involve in Aerobactin transportation in E. coli strains. It is ferric-aerobactin receptor.

Metal Ion Chelator

We have used the cytoplasmic domain of Human Copper transporter as a divalent ion chelator. This is to be used as an analogue for the Aerobactin gene for all the experimental purposes in the project. It is known that this protein has the capability to chelate a variety of divalent ion.

Part Number	Part type	Part Function
BBa_K3011012	Basic	Metal Ion chelator

NsrR binding site

NsrR is a nitric oxide (NO) sensitive transcriptional repressor. In absence of NO it binds to a particular DNA sequence as a homodimer and block transcription. In presence of NO, NsrR binds to NO using Fe-S cluster, due to this NsrR can’t bind to DNA.

23bp NsrR binding site is basically a 11bp inverted repeat with a spacing of 1bp.

Different Promoters	NsrR binding sites
ytfE	aagatgcatttaaaatacatctt
hmp	aagatgcatttgagatacatcaa
hmp-2	aagaaccatttacattgcagggc
ygbA	aagatgtaatataaatacatctt
ygbA-2	aagatgctgttttgcagcttttg
hcp	aacatgtatattaaatataactt
hcp-2	aagttgcatgaaaaatccctttt

Part name	Part type	Part function
BBa_K3011006	Basic	NsrR binding site.

References

1. DNA Sequence of a ColV Plasmid and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Escherichia coli Strains. DOI: 10.1128/JB.188.2.745-758.2006
2. NsrR targets in the Escherichia coli genome - new insights into DNA sequence requirements for binding and a role for NsrR in the regulation of motility. DOI: 10.1111/j.1365-2958.2009.06799.x
3. Escherichia coli A2363 plasmid pAPEC-O2-ColV, complete sequence