Difference between revisions of "Team:Ruperto Carola/Experiments"

 
(3 intermediate revisions by the same user not shown)
Line 19: Line 19:
 
       <div class="card-body">
 
       <div class="card-body">
 
<h2>LB-Medium</h2>
 
<h2>LB-Medium</h2>
−
Make it a table:
+
<table>
−
Chemical Menge [g/l]
+
  <tr>
−
Hefeextrakt 5
+
    <th>Chemical</th>
−
Pepton/ Trypton 10
+
    <th>amount in [g/l]</th>
−
NaCl 10
+
 
 +
  </tr>
 +
  <tr>
 +
    <td>yeastextrakt</td>
 +
    <td>5</td>
 +
 
 +
  </tr>
 +
  <tr>
 +
    <td>pepton/ trypton</td>
 +
    <td>10</td>
 +
 
 +
  </tr>
 +
<tr>
 +
    <td>NaCl</td>
 +
    <td>10</td>
 +
 
 +
  </tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<h2>Synthetic complete (SC)</h2>
 +
<table style>
 +
  <tr>
 +
    <th>Component</th>
 +
    <th>Final concentration</th>
 +
  </tr>
 +
  <tr>
 +
    <td> Bacto yeast nitrogen base without amino acids</td>
 +
    <td>6.7 g/l</td>
 +
  </tr>
 +
  <tr>
 +
    <td>Amino-acid (dropout) mix </td>
 +
    <td>2 g/l</td>
 +
  </tr>
 +
<tr>
 +
    <td>Glucose</td>
 +
    <td>2% (w/v)</td>
 +
  </tr>
 +
<tr>
 +
    <td>Bacto-agar (for solid media agar plates)</td>
 +
    <td>20 g/l</td>
 +
  </tr>
 +
</table>
  
 
       </div>
 
       </div>
Line 40: Line 84:
 
     <div id="collapseTwo" class="collapse" aria-labelledby="headingTwo" data-parent="#accordionExample">
 
     <div id="collapseTwo" class="collapse" aria-labelledby="headingTwo" data-parent="#accordionExample">
 
       <div class="card-body">
 
       <div class="card-body">
−
       <h2>TE</h2>
+
       <h2>TAE</h2>
−
Make it a table:
+
 
−
Reagent Volume
+
<table>
−
Final concentration
+
  <tr>
−
1M Tris-Cl (pH 8.0) 1 mL 10 mM
+
    <th>Reagent</th>
−
0.5M EDTA (pH 8.0) 0.2 mL 1 mM
+
    <th> Volume </th>
−
Distilled H2O 98.8 mL
+
    <th>Final concentration</th>
 +
  </tr>
 +
  <tr>
 +
    <td>1M Tris-Cl (pH 8.0) </td>
 +
    <td>1 nL</td>
 +
    <td>10 mM</td>
 +
  </tr>
 +
  <tr>
 +
    <td>0.5M EDTA (pH 8.0)</td>
 +
    <td>0.2 mL</td>
 +
    <td>1 mM</td>
 +
  </tr>
 +
  <tr>
 +
    <td>Distilled H2O</td>
 +
    <td>98.8 mL</td>
 +
    <td></td>
 +
  </tr>
 +
</table>
 +
 
 
       </div>
 
       </div>
 
     </div>
 
     </div>
Line 62: Line 124:
 
     <div id="collapseThree" class="collapse" aria-labelledby="headingThree" data-parent="#accordionExample">
 
     <div id="collapseThree" class="collapse" aria-labelledby="headingThree" data-parent="#accordionExample">
 
       <div class="card-body">
 
       <div class="card-body">
 +
<h2>LiSORB</h2>
 +
<table>
 +
  <tr>
 +
    <th>Component</th>
 +
    <th>Final concentration</th>
 +
  </tr>
 +
  <tr>
 +
    <td> LiOAc</td>
 +
    <td>100 mM</td>
 +
  </tr>
 +
  <tr>
 +
    <td>Tris HCl</td>
 +
    <td>10 mM</td>
 +
  </tr>
 +
<tr>
 +
    <td>EDTA (pH 8.0 with NaOH)</td>
 +
    <td>1 mM</td>
 +
  </tr>
 +
<tr>
 +
    <td>Sorbitol</td>
 +
    <td>1 M</td>
 +
  </tr>
 +
<tr>
 +
    <td>Salmon sperm DNA (10 mg/ml)</td>
 +
    <td>4 mg/ml</td>
 +
  </tr>
 +
</table>
 +
 +
<h2>LiPEG</h2>
 +
 +
<table style="width:100%">
 +
  <tr>
 +
    <th>Component</th>
 +
    <th>Final concentration</th>
 +
  </tr>
 +
  <tr>
 +
    <td> LiOAc</td>
 +
    <td>100 mM</td>
 +
  </tr>
 +
  <tr>
 +
    <td>Tris HCl</td>
 +
    <td>10 mM</td>
 +
  </tr>
 +
<tr>
 +
    <td>EDTA (pH 8.0 with NaOH)</td>
 +
    <td>1 mM</td>
 +
  </tr>
 +
<tr>
 +
    <td>Polyethylene glycol (PEG) 3350 </td>
 +
    <td>40%</td>
 +
  </tr>
 +
</table>
 +
 +
 
PCR
 
PCR
 +
 
Restriction digest
 
Restriction digest
 
Yeast and bacterial transformation
 
Yeast and bacterial transformation
Line 97: Line 214:
 
     <div id="collapse5" class="collapse" aria-labelledby="heading5" data-parent="#accordionExample">
 
     <div id="collapse5" class="collapse" aria-labelledby="heading5" data-parent="#accordionExample">
 
       <div class="card-body">
 
       <div class="card-body">
−
         Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
+
          
 
       </div>
 
       </div>
 
     </div>
 
     </div>
Line 127: Line 244:
 
     <div id="collapse7" class="collapse" aria-labelledby="heading7" data-parent="#accordionExample">
 
     <div id="collapse7" class="collapse" aria-labelledby="heading7" data-parent="#accordionExample">
 
       <div class="card-body">
 
       <div class="card-body">
−
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
+
 
 +
<table>
 +
  <tr>
 +
    <th>Name F</th>
 +
    <th>Name R</th>
 +
    <th>Sequence F</th>
 +
    <th>Sequence R</th>
 +
  </tr>
 +
  <tr>
 +
    <td>STE2 rev  overhang 415</td>
 +
    <td>STE2 for overhang 415</td>
 +
    <td>agggaacaaagctggagctccaccgcggtggcggccgctctagaactagtggatccd</t>
 +
    <td>accgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag</t>
 +
  </tr>
 +
  <tr>
 +
    <td>S3 knock-out</td>
 +
    <td>S2 knock-out</td>
 +
    <td> ACAGGAAAATGAGTCATTGAGATCGAAACTTTTCAACCTATCAATCAACAATCCCCGTACGCTGCAGGTCGAC </t>
 +
    <td>AGAGAGTGACTGAGTGTTACATTAAATATATTTATATATAAACGTATGATATTTAATCGATGAATTCG</t>
 +
  </tr>
 +
  <tr>
 +
    <td>STE2 forBamh1</td>
 +
    <td>STE2 for Bam H1 </td>
 +
    <td> TTTTTGGATCCATGTCTGATGCGGCTCCTTC</t>
 +
    <td>TCGAGGGGGGGCCCGGTACCCTTATTATTATCTTCAGTCCAG</t>
 +
  </tr>
 +
</table>
 +
 
 +
     
 
       </div>
 
       </div>
 
     </div>
 
     </div>

Latest revision as of 04:00, 22 October 2019

Protocols


LB-Medium

Chemical amount in [g/l]
yeastextrakt 5
pepton/ trypton 10
NaCl 10

Synthetic complete (SC)

Component Final concentration
Bacto yeast nitrogen base without amino acids 6.7 g/l
Amino-acid (dropout) mix 2 g/l
Glucose 2% (w/v)
Bacto-agar (for solid media agar plates) 20 g/l

TAE

Reagent Volume Final concentration
1M Tris-Cl (pH 8.0) 1 nL 10 mM
0.5M EDTA (pH 8.0) 0.2 mL 1 mM
Distilled H2O 98.8 mL

LiSORB

Component Final concentration
LiOAc 100 mM
Tris HCl 10 mM
EDTA (pH 8.0 with NaOH) 1 mM
Sorbitol 1 M
Salmon sperm DNA (10 mg/ml) 4 mg/ml

LiPEG

Component Final concentration
LiOAc 100 mM
Tris HCl 10 mM
EDTA (pH 8.0 with NaOH) 1 mM
Polyethylene glycol (PEG) 3350 40%
PCR Restriction digest Yeast and bacterial transformation Gel electrophoresis

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Name F Name R Sequence F Sequence R
STE2 rev overhang 415 STE2 for overhang 415 agggaacaaagctggagctccaccgcggtggcggccgctctagaactagtggatccd accgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag
S3 knock-out S2 knock-out ACAGGAAAATGAGTCATTGAGATCGAAACTTTTCAACCTATCAATCAACAATCCCCGTACGCTGCAGGTCGAC AGAGAGTGACTGAGTGTTACATTAAATATATTTATATATAAACGTATGATATTTAATCGATGAATTCG
STE2 forBamh1 STE2 for Bam H1 TTTTTGGATCCATGTCTGATGCGGCTCCTTC TCGAGGGGGGGCCCGGTACCCTTATTATTATCTTCAGTCCAG

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

You opened the first week and this last one, I guess? Great, so as you might know: this one is the week after wiki freeze, so the lab will transform into a boilerroom similiar to the sponsoring phase. Its selling time again. $$$