Team:Ruperto Carola/Experiments
Protocols
LB-Medium
| Chemical | amount in [g/l] |
|---|---|
| yeastextrakt | 5 |
| pepton/ trypton | 10 |
| NaCl | 10 |
Synthetic complete (SC)
| Component | Final concentration |
|---|---|
| Bacto yeast nitrogen base without amino acids | 6.7 g/l |
| Amino-acid (dropout) mix | 2 g/l |
| Glucose | 2% (w/v) |
| Bacto-agar (for solid media agar plates) | 20 g/l |
TAE
| Reagent | Volume | Final concentration |
|---|---|---|
| 1M Tris-Cl (pH 8.0) | 1 nL | 10 mM |
| 0.5M EDTA (pH 8.0) | 0.2 mL | 1 mM |
| Distilled H2O | 98.8 mL |
LiSORB
| Component | Final concentration |
|---|---|
| LiOAc | 100 mM |
| Tris HCl | 10 mM |
| EDTA (pH 8.0 with NaOH) | 1 mM |
| Sorbitol | 1 M |
| Salmon sperm DNA (10 mg/ml) | 4 mg/ml |
LiPEG
| Component | Final concentration |
|---|---|
| LiOAc | 100 mM |
| Tris HCl | 10 mM |
| EDTA (pH 8.0 with NaOH) | 1 mM |
| Polyethylene glycol (PEG) 3350 | 40% |
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
| Name F | Name R | Sequence F | Sequence R |
|---|---|---|---|
| STE2 rev overhang 415 | STE2 for overhang 415 | agggaacaaagctggagctccaccgcggtggcggccgctctagaactagtggatccd | accgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag |
| S3 knock-out | S2 knock-out | ACAGGAAAATGAGTCATTGAGATCGAAACTTTTCAACCTATCAATCAACAATCCCCGTACGCTGCAGGTCGAC | AGAGAGTGACTGAGTGTTACATTAAATATATTTATATATAAACGTATGATATTTAATCGATGAATTCG |
| STE2 forBamh1 | STE2 for Bam H1 | TTTTTGGATCCATGTCTGATGCGGCTCCTTC | TCGAGGGGGGGCCCGGTACCCTTATTATTATCTTCAGTCCAG |
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
You opened the first week and this last one, I guess? Great, so as you might know: this one is the week after wiki freeze, so the lab will transform into a boilerroom similiar to the sponsoring phase. Its selling time again. $$$