Difference between revisions of "Team:Ruperto Carola/Experiments"

 
(14 intermediate revisions by 3 users not shown)
Line 3: Line 3:
  
 
<div class="container">
 
<div class="container">
  <h2>Test of the MathJax Integration</h2>
 
  <p>
 
    When \(a \ne 0\), there are two solutions to \(ax^2 + bx + c = 0\) and they are
 
    \[x = {-b \pm \sqrt {b^2-4ac} \over 2a}.\]
 
  </p>
 
</div>
 
  
<div class="column full_size">
+
<h1 class="title" style= "line-height: 3rem !important">Protocols</h1>
 +
<br />
 +
<div class="accordion" id="accordionExample">
 +
  <div class="card">
 +
    <div class="card-header" id="headingOne">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link" type="button" data-toggle="collapse" data-target="#collapseOne" aria-expanded="true" aria-controls="collapseOne">
 +
          Media
 +
        </button>
 +
      </h2>
 +
    </div>
  
<h1>Experiments</h1>
+
    <div id="collapseOne" class="collapse show" aria-labelledby="headingOne" data-parent="#accordionExample">
<p>Describe the research, experiments, and protocols you used in your iGEM project. These should be detailed enough for another team to repeat your experiments.</p>
+
      <div class="card-body">
 +
<h2>LB-Medium</h2>
 +
<table>
 +
  <tr>
 +
    <th>Chemical</th>
 +
    <th>amount in [g/l]</th>
 +
 
 +
  </tr>
 +
  <tr>
 +
    <td>yeastextrakt</td>
 +
    <td>5</td>
  
<p>
+
  </tr>
Please remember to put all characterization and measurement data for your parts on the corresponding Registry part pages.
+
  <tr>
</p>
+
    <td>pepton/ trypton</td>
 +
    <td>10</td>
  
</div>
+
  </tr>
 +
<tr>
 +
    <td>NaCl</td>
 +
    <td>10</td>
  
 +
  </tr>
  
 +
</table>
  
<div class="column two_thirds_size">
 
<h3>What should this page contain?</h3>
 
<ul>
 
<li> Protocols </li>
 
<li> Experiments </li>
 
<li> Documentation of the development of your project </li>
 
</ul>
 
  
 +
 +
<h2>Synthetic complete (SC)</h2>
 +
<table style>
 +
  <tr>
 +
    <th>Component</th>
 +
    <th>Final concentration</th>
 +
  </tr>
 +
  <tr>
 +
    <td> Bacto yeast nitrogen base without amino acids</td>
 +
    <td>6.7 g/l</td>
 +
  </tr>
 +
  <tr>
 +
    <td>Amino-acid (dropout) mix </td>
 +
    <td>2 g/l</td>
 +
  </tr>
 +
<tr>
 +
    <td>Glucose</td>
 +
    <td>2% (w/v)</td>
 +
  </tr>
 +
<tr>
 +
    <td>Bacto-agar (for solid media agar plates)</td>
 +
    <td>20 g/l</td>
 +
  </tr>
 +
</table>
 +
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
 +
  <div class="card">
 +
    <div class="card-header" id="headingTwo">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapseTwo" aria-expanded="false" aria-controls="collapseTwo">
 +
          Buffer
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapseTwo" class="collapse" aria-labelledby="headingTwo" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
      <h2>TAE</h2>
 +
 +
<table>
 +
  <tr>
 +
    <th>Reagent</th>
 +
    <th> Volume </th>
 +
    <th>Final concentration</th>
 +
  </tr>
 +
  <tr>
 +
    <td>1M Tris-Cl (pH 8.0) </td>
 +
    <td>1 nL</td>
 +
    <td>10 mM</td>
 +
  </tr>
 +
  <tr>
 +
    <td>0.5M EDTA (pH 8.0)</td>
 +
    <td>0.2 mL</td>
 +
    <td>1 mM</td>
 +
  </tr>
 +
  <tr>
 +
    <td>Distilled H2O</td>
 +
    <td>98.8 mL</td>
 +
    <td></td>
 +
  </tr>
 +
</table>
 +
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
 +
  <div class="card">
 +
    <div class="card-header" id="headingThree">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapseThree" aria-expanded="false" aria-controls="collapseThree">
 +
          Stocks
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapseThree" class="collapse" aria-labelledby="headingThree" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
<h2>LiSORB</h2>
 +
<table>
 +
  <tr>
 +
    <th>Component</th>
 +
    <th>Final concentration</th>
 +
  </tr>
 +
  <tr>
 +
    <td> LiOAc</td>
 +
    <td>100 mM</td>
 +
  </tr>
 +
  <tr>
 +
    <td>Tris HCl</td>
 +
    <td>10 mM</td>
 +
  </tr>
 +
<tr>
 +
    <td>EDTA (pH 8.0 with NaOH)</td>
 +
    <td>1 mM</td>
 +
  </tr>
 +
<tr>
 +
    <td>Sorbitol</td>
 +
    <td>1 M</td>
 +
  </tr>
 +
<tr>
 +
    <td>Salmon sperm DNA (10 mg/ml)</td>
 +
    <td>4 mg/ml</td>
 +
  </tr>
 +
</table>
 +
 +
<h2>LiPEG</h2>
 +
 +
<table style="width:100%">
 +
  <tr>
 +
    <th>Component</th>
 +
    <th>Final concentration</th>
 +
  </tr>
 +
  <tr>
 +
    <td> LiOAc</td>
 +
    <td>100 mM</td>
 +
  </tr>
 +
  <tr>
 +
    <td>Tris HCl</td>
 +
    <td>10 mM</td>
 +
  </tr>
 +
<tr>
 +
    <td>EDTA (pH 8.0 with NaOH)</td>
 +
    <td>1 mM</td>
 +
  </tr>
 +
<tr>
 +
    <td>Polyethylene glycol (PEG) 3350 </td>
 +
    <td>40%</td>
 +
  </tr>
 +
</table>
 +
 +
 +
PCR
 +
 +
Restriction digest
 +
Yeast and bacterial transformation
 +
Gel electrophoresis
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading4">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse4" aria-expanded="false" aria-controls="collapse4">
 +
          Kits & reagents
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse4" class="collapse" aria-labelledby="heading4" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading5">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse5" aria-expanded="false" aria-controls="collapse5">
 +
          Strains
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse5" class="collapse" aria-labelledby="heading5" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
       
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading6">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse6" aria-expanded="false" aria-controls="collapse6">
 +
          Backbones
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse6" class="collapse" aria-labelledby="heading6" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading7">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse7" aria-expanded="false" aria-controls="collapse7">
 +
          Primer
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse7" class="collapse" aria-labelledby="heading7" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
 +
<table>
 +
  <tr>
 +
    <th>Name F</th>
 +
    <th>Name R</th>
 +
    <th>Sequence F</th>
 +
    <th>Sequence R</th>
 +
  </tr>
 +
  <tr>
 +
    <td>STE2 rev  overhang 415</td>
 +
    <td>STE2 for overhang 415</td>
 +
    <td>agggaacaaagctggagctccaccgcggtggcggccgctctagaactagtggatccd</t>
 +
    <td>accgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag</t>
 +
  </tr>
 +
  <tr>
 +
    <td>S3 knock-out</td>
 +
    <td>S2 knock-out</td>
 +
    <td> ACAGGAAAATGAGTCATTGAGATCGAAACTTTTCAACCTATCAATCAACAATCCCCGTACGCTGCAGGTCGAC </t>
 +
    <td>AGAGAGTGACTGAGTGTTACATTAAATATATTTATATATAAACGTATGATATTTAATCGATGAATTCG</t>
 +
  </tr>
 +
  <tr>
 +
    <td>STE2 forBamh1</td>
 +
    <td>STE2 for Bam H1 </td>
 +
    <td> TTTTTGGATCCATGTCTGATGCGGCTCCTTC</t>
 +
    <td>TCGAGGGGGGGCCCGGTACCCTTATTATTATCTTCAGTCCAG</t>
 +
  </tr>
 +
</table>
 +
 +
     
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading8">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse8" aria-expanded="false" aria-controls="collapse8">
 +
          Week 30
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse8" class="collapse" aria-labelledby="heading8" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading9">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse9" aria-expanded="false" aria-controls="collapse9">
 +
          Week 31
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse9" class="collapse" aria-labelledby="heading9" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading10">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse10" aria-expanded="false" aria-controls="collapse10">
 +
          Week 32
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse10" class="collapse" aria-labelledby="heading10" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading11">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse11" aria-expanded="false" aria-controls="collapse11">
 +
          Week 33
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse11" class="collapse" aria-labelledby="heading11" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading12">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse12" aria-expanded="false" aria-controls="collapse12">
 +
          Week 34
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse12" class="collapse" aria-labelledby="heading12" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading13">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse13" aria-expanded="false" aria-controls="collapse13">
 +
          Week 35
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse13" class="collapse" aria-labelledby="heading13" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading14">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse14" aria-expanded="false" aria-controls="collapse14">
 +
          Week 36
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse14" class="collapse" aria-labelledby="heading14" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading15">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse15" aria-expanded="false" aria-controls="collapse15">
 +
          Week 37
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse15" class="collapse" aria-labelledby="heading15" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading16">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse16" aria-expanded="false" aria-controls="collapse16">
 +
          Week 38
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse16" class="collapse" aria-labelledby="heading16" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading17">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse17" aria-expanded="false" aria-controls="collapse17">
 +
          Week 39
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse17" class="collapse" aria-labelledby="heading17" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading18">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse18" aria-expanded="false" aria-controls="collapse18">
 +
          Week 40
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse18" class="collapse" aria-labelledby="headingThree18" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading19">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse19" aria-expanded="false" aria-controls="collapse19">
 +
          Week 41
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse19" class="collapse" aria-labelledby="heading19" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading20">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse20" aria-expanded="false" aria-controls="collapse20">
 +
          Week 42
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse20" class="collapse" aria-labelledby="heading20" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
<div class="card">
 +
    <div class="card-header" id="heading21">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse21" aria-expanded="false" aria-controls="collapse21">
 +
          Week 42
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse21" class="collapse" aria-labelledby="heading21" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
        Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.
 +
      </div>
 +
    </div>
 +
  </div>
 +
 +
  <div class="card">
 +
    <div class="card-header" id="heading22">
 +
      <h2 class="mb-0">
 +
        <button class="btn btn-link collapsed" type="button" data-toggle="collapse" data-target="#collapse22" aria-expanded="false" aria-controls="collapse22">
 +
          Week 43
 +
        </button>
 +
      </h2>
 +
    </div>
 +
    <div id="collapse22" class="collapse" aria-labelledby="heading22" data-parent="#accordionExample">
 +
      <div class="card-body">
 +
You opened the first week and this last one, I guess? Great, so as you might know: this one is the week after wiki freeze, so the lab will transform into a boilerroom similiar to the sponsoring phase. Its selling time again. $$$
 +
 +
      </div>
 +
    </div>
 +
  </div>
 
</div>
 
</div>
  
<div class="column third_size">
 
<div class="highlight decoration_A_full">
 
<h3>Inspiration</h3>
 
<ul>
 
<li><a href="https://2014.igem.org/Team:Colombia/Protocols">2014 Colombia </a></li>
 
<li><a href="https://2014.igem.org/Team:Imperial/Protocols">2014 Imperial </a></li>
 
<li><a href="https://2014.igem.org/Team:Caltech/Project/Experiments">2014 Caltech </a></li>
 
</ul>
 
</div>
 
 
</div>
 
</div>
  
  
 
+
<ul>
 +
<li><a href="https://2018.igem.org/Team:Munich/Notebook">2018 Munich</a></li>
 +
<li><a href="https://2014.igem.org/Team:ATOMS-Turkiye/Notebook">2014 ATOMS-Turkiye</a></li>
 +
<li><a href="https://2014.igem.org/Team:Tec-Monterrey/ITESM14_project.html#tab_notebook">2014 Tec Monterrey</a></li>
 +
<li><a href="https://2014.igem.org/Team:Kyoto/Notebook/Magnetosome_Formation#title">2014 Kyoto</a></li>
 +
<li><a href="https://2014.igem.org/Team:Cornell/notebook">2014 Cornell</a></li>
 +
</ul>
 +
</div>
 +
</div>
  
 
</html>
 
</html>

Latest revision as of 04:00, 22 October 2019

Protocols


LB-Medium

Chemical amount in [g/l]
yeastextrakt 5
pepton/ trypton 10
NaCl 10

Synthetic complete (SC)

Component Final concentration
Bacto yeast nitrogen base without amino acids 6.7 g/l
Amino-acid (dropout) mix 2 g/l
Glucose 2% (w/v)
Bacto-agar (for solid media agar plates) 20 g/l

TAE

Reagent Volume Final concentration
1M Tris-Cl (pH 8.0) 1 nL 10 mM
0.5M EDTA (pH 8.0) 0.2 mL 1 mM
Distilled H2O 98.8 mL

LiSORB

Component Final concentration
LiOAc 100 mM
Tris HCl 10 mM
EDTA (pH 8.0 with NaOH) 1 mM
Sorbitol 1 M
Salmon sperm DNA (10 mg/ml) 4 mg/ml

LiPEG

Component Final concentration
LiOAc 100 mM
Tris HCl 10 mM
EDTA (pH 8.0 with NaOH) 1 mM
Polyethylene glycol (PEG) 3350 40%
PCR Restriction digest Yeast and bacterial transformation Gel electrophoresis

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Name F Name R Sequence F Sequence R
STE2 rev overhang 415 STE2 for overhang 415 agggaacaaagctggagctccaccgcggtggcggccgctctagaactagtggatccd accgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag
S3 knock-out S2 knock-out ACAGGAAAATGAGTCATTGAGATCGAAACTTTTCAACCTATCAATCAACAATCCCCGTACGCTGCAGGTCGAC AGAGAGTGACTGAGTGTTACATTAAATATATTTATATATAAACGTATGATATTTAATCGATGAATTCG
STE2 forBamh1 STE2 for Bam H1 TTTTTGGATCCATGTCTGATGCGGCTCCTTC TCGAGGGGGGGCCCGGTACCCTTATTATTATCTTCAGTCCAG

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

Anim pariatur cliche reprehenderit, enim eiusmod high life accusamus terry richardson ad squid. 3 wolf moon officia aute, non cupidatat skateboard dolor brunch. Food truck quinoa nesciunt laborum eiusmod. Brunch 3 wolf moon tempor, sunt aliqua put a bird on it squid single-origin coffee nulla assumenda shoreditch et. Nihil anim keffiyeh helvetica, craft beer labore wes anderson cred nesciunt sapiente ea proident. Ad vegan excepteur butcher vice lomo. Leggings occaecat craft beer farm-to-table, raw denim aesthetic synth nesciunt you probably haven't heard of them accusamus labore sustainable VHS.

You opened the first week and this last one, I guess? Great, so as you might know: this one is the week after wiki freeze, so the lab will transform into a boilerroom similiar to the sponsoring phase. Its selling time again. $$$