Difference between revisions of "Team:IISER Kolkata/Basic Part"

(Prototype team page)
 
 
(26 intermediate revisions by 4 users not shown)
Line 1: Line 1:
−
{{IISER_Kolkata}}
 
 
<html>
 
<html>
 +
  
 +
<link rel="stylesheet" href="https://2019.igem.org/wiki/index.php?title=Team:IISER_Kolkata/.css&action=raw&ctype=text/css"/>
 +
<link rel="stylesheet" href="https://2019.igem.org/wiki/index.php?title=Team:IISER_Kolkata/common.css&action=raw&ctype=text/css"/>
  
−
<div class="column full_size judges-will-not-evaluate">
+
<script src="https://ajax.googleapis.com/ajax/libs/jquery/3.1.1/jquery.min.js"></script>
−
<h3>★  ALERT! </h3>
+
<script src="https://2019.igem.org/wiki/index.php?title=Team:IISER_Kolkata/.js&action=raw&ctype=text/javascript" defer></script>
−
<p>This page is used by the judges to evaluate your team for the <a href="https://2019.igem.org/Judging/Medals">medal criterion</a> or <a href="https://2019.igem.org/Judging/Awards"> award listed below</a>. </p>
+
<script src="https://2019.igem.org/wiki/index.php?title=Team:IISER_Kolkata/common.js&action=raw&ctype=text/javascript" defer></script>
−
<p> Delete this box in order to be evaluated for this medal criterion and/or award. See more information at <a href="https://2019.igem.org/Judging/Pages_for_Awards"> Instructions for Pages for awards</a>.</p>
+
−
</div>
+
<nav id="navbar">
 +
<div id="mobdiv">
 +
<div id="logo"><a href="https://2019.igem.org/Team:IISER_Kolkata"><img src="https://static.igem.org/mediawiki/2019/0/0c/T--IISER_Kolkata--unleash.png"/></a></div>
 +
<div id="menuicon">
 +
<span id="bar1"></span>
 +
<span id="bar2"></span>
 +
<span id="bar3"></span>
 +
</div>
 +
</div>
 +
<ul>
 +
<li id="homeMenu"><div><a href="https://2019.igem.org/Team:IISER_Kolkata">Home</a></div></li>
 +
<li id="teamMenu"><div><a href="">Team</a></div>
 +
<ul class="dropdown">
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Team">Members</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Guides">Guides</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Collaborations">Collaborations</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Attributions">Attributions</a></div></li>
 +
</ul>
 +
</li>
 +
<li id="projectMenu"><div><a href="">Project</a></div>
 +
<ul class="dropdown">
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Description">Description</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Design">Design</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Experiments">Experiments</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Notebook">Notebook</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Contribution">Contribution</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Results">Results</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Model">Model</a></div></li>
 +
</ul>
 +
</li>
 +
<li id="partsMenu"><div><a href="">Parts</a></div>
 +
<ul class="dropdown">
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Parts">Overview</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Basic_Part">Basic</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Composite_Part">Composite</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Part_Collection">Collection</a></div></li>
 +
</ul>
 +
</li>
 +
<li id="safetyMenu"><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Safety">Safety</a></div></li>
 +
<li id="humanityMenu"><div><a href="">Humanity</a></div>
 +
<ul class="dropdown">
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Practices_Overview">Overview</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Human_Practices">Integrated&nbsp;HP</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Public_Engagement">Engagement</a></div></li>
 +
<li><div><a href="https://2019.igem.org/Team:IISER_Kolkata/Social_Studies">Social</a></div></li>
 +
</ul>
 +
</li>
 +
</ul>
 +
</nav>
 +
           
 +
                <div id="container">
 +
<h1 class="heading">Basic Parts</h1>
  
 +
<section class="sec white">
 +
<h3>Genes involved in Aerobactin biosynthesis</h3>
 +
<p>Aerobactin is an iron chelator (siderophore) produced by different strains of E. coli. It is a virulence factor enabling E. coli to sequester iron in iron-poor environments and helps bacteria in colonization inside the host. Aerobactin producing operon is a part of ColV plasmid of E. coli strains. Five genes are present on Aerobactin producing operon, four of them (iucA, iucB, iucC, iucD) are involved in Aerobactin synthesis and one (iutA) is responsible for transportation of Aerobactin.</p>
 +
<figure>
 +
<img class="fullimage" src="https://static.igem.org/mediawiki/2019/5/56/T--IISER_Kolkata--Aerobactin_production.png"/>
 +
<figcaption>Aerobactin Production</figcaption>
 +
</figure>
 +
<table class="tabular">
 +
  <tr>
 +
    <th>Part name</th>
 +
    <th>Part type</th>
 +
    <th>Part function</th>
 +
  </tr>
 +
  <tr>
 +
    <td><a href="http://parts.igem.org/Part:BBa_K3011001">BBa_K3011001</a></td>
 +
    <td>Basic</td>
 +
    <td>iucA, involve in Aerobactin biosynthesis in E. coli strains.</td>
 +
  </tr>
 +
  <tr>
 +
    <td><a href="http://parts.igem.org/Part:BBa_K3011002">BBa_K3011002</a></td>
 +
    <td>Basic</td>
 +
    <td>iucB, involve in Aerobactin biosynthesis in E. coli strains.</td>
 +
  </tr>
 +
  <tr>
 +
    <td><a href="http://parts.igem.org/Part:BBa_K3011003">BBa_K3011003</a></td>
 +
    <td>Basic</td>
 +
    <td>iucC, involve in Aerobactin biosynthesis in E. coli strains.</td>
 +
  </tr>
 +
  <tr>
 +
    <td><a href="http://parts.igem.org/Part:BBa_K3011004">BBa_K3011004</a></td>
 +
    <td>Basic</td>
 +
    <td>iucD, involve in Aerobactin biosynthesis in E. coli strains.</td>
 +
  </tr>
 +
  <tr>
 +
    <td><a href="http://parts.igem.org/Part:BBa_K3011005">BBa_K3011005</a></td>
 +
    <td>Basic</td>
 +
    <td>iutA, involve in Aerobactin transportation in E. coli strains. It is ferric-aerobactin receptor.</td>
 +
  </tr>
 +
</table>
 +
</section>
  
−
<div class="clear"></div>
+
<section class="sec white">
−
 
+
<h3>Metal Ion Chelator</h3>
−
 
+
<p>We have used the cytoplasmic domain of Human Copper transporter as a divalent ion chelator. This is to be used as an analogue for the Aerobactin gene for all the experimental purposes in the project. It is known that this protein has the capability to chelate a variety of divalent ion.</p>
−
 
+
                <table class="tabular">
−
<div class="column full_size">
+
  <tr>
−
<h1>Basic Parts</h1>
+
    <th>Part Number</th>
−
<p>
+
    <th>Part type</th>
−
A <b>basic part</b> is a functional unit of DNA that cannot be subdivided into smaller component parts. <a href="http://parts.igem.org/wiki/index.php/Part:BBa_R0051">BBa_R0051</a> is an example of a basic part, a promoter regulated by lambda cl.
+
                    <th>Part Function</th>
−
</p>
+
                  </tr>
−
 
+
                  <tr>
−
<p>Most genetically-encoded functions have not yet been converted to BioBrick parts. Thus, there are <b>many</b> opportunities to find new, cool, and important genetically encoded functions, and refine and convert the DNA encoding these functions into BioBrick standard biological parts. </p>
+
    <td><a href="http://parts.igem.org/Part:BBa_K3011012">BBa_K3011012</a></td>
−
</div>
+
    <td>Basic</td>
−
 
+
    <td>Metal Ion chelator</td>
−
 
+
  </tr>
−
<div class="column full_size">
+
                </table>
−
<div class="highlight decoration_background">
+
</section>
−
<h3>Note</h3>
+
−
<p>This page should list all the basic parts your team has made during your project and include direct links to your Parts main pages on the Registry. <b>You must add all characterization information for your parts on Parts Main Page on the Registry.</b> You should <b>not</b> put characterization information on this page. Remember judges will only look at the first part in the list for the Best Basic Part award, so put your best part first!</p>
+
<section class="sec white">
−
</div>
+
<h3>NsrR binding site</h3>
−
</div>
+
<p>NsrR is a nitric oxide (NO) sensitive transcriptional repressor. In absence of NO it binds to a particular DNA sequence as a homodimer and block transcription. In presence of NO, NsrR binds to NO using Fe-S cluster, due to this NsrR can’t bind to DNA.</p>
−
 
+
<p>23bp NsrR binding site is basically a 11bp inverted repeat with a spacing of 1bp. </p>
−
 
+
<table class="tabular">
−
<div class="column full_size">
+
  <tr>
−
<h3>Best Basic Part Special Prize</h3>
+
    <th>Different Promoters</th>
−
 
+
    <th>NsrR binding sites</th>
−
<p> To be eligible for this award, this part <b>must be well documented on the part's Main Page on the Registry</b>. If you have a part you wish to nominate your team for this <a href="https://2019.igem.org/Judging/Awards">special prize</a>, make sure you add your part number to your <a href="https://2019.igem.org/Judging/Judging_Form">judging form</a> and delete the alert box at the top of this page.
+
  </tr>
−
 
+
  <tr>
−
<br><br>
+
    <td>ytfE</td>
−
<b>Please note:</b> Judges will only look at the first part number you list, so please only enter ONE (1) part number in the judging form for this prize. </p>
+
    <td>aagatgcatttaaaatacatctt</td>
−
</div>
+
  </tr>
−
 
+
  <tr>
 +
    <td>hmp</td>
 +
    <td>aagatgcatttgagatacatcaa</td>
 +
  </tr>
 +
  <tr>
 +
    <td>hmp-2</td>
 +
    <td>aagaaccatttacattgcagggc</td>
 +
  </tr>
 +
  <tr>
 +
    <td>ygbA</td>
 +
    <td>aagatgtaatataaatacatctt</td>
 +
  </tr>
 +
  <tr>
 +
    <td>ygbA-2</td>
 +
    <td>aagatgctgttttgcagcttttg</td>
 +
  </tr>
 +
  <tr>
 +
    <td>hcp</td>
 +
    <td>aacatgtatattaaatataactt</td>
 +
  </tr>
 +
  <tr>
 +
    <td>hcp-2</td>
 +
    <td>aagttgcatgaaaaatccctttt</td>
 +
  </tr>
 +
</table>
 +
<table class="tabular">
 +
  <tr>
 +
    <th>Part name</th>
 +
    <th>Part type</th>
 +
    <th>Part function</th>
 +
  </tr>
 +
  <tr>
 +
    <td><a href="http://parts.igem.org/Part:BBa_K3011006">BBa_K3011006</a></td>
 +
    <td>Basic</td>
 +
    <td>NsrR binding site.</td>
 +
  </tr>
 +
</table>
 +
</section>
  
 +
<section class="sec white">
 +
<h3>References</h3>
 +
<ol>
 +
<li>DNA Sequence of a ColV Plasmid and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Escherichia coli Strains. <strong>DOI: 10.1128/JB.188.2.745-758.2006</strong></li>
 +
<li>NsrR targets in the Escherichia coli genome - new insights into DNA sequence requirements for binding and a role for NsrR in the regulation of motility. <strong>DOI: 10.1111/j.1365-2958.2009.06799.x</strong></li>
 +
<li><a href="https://www.ncbi.nlm.nih.gov/nuccore/NC_007675" target="_blank">Escherichia coli A2363 plasmid pAPEC-O2-ColV, complete sequence</a></li>
 +
</ol>
 +
</section>
  
 +
                </div>
  
  
 
</html>
 
</html>

Latest revision as of 02:20, 22 October 2019

Basic Parts

Genes involved in Aerobactin biosynthesis

Aerobactin is an iron chelator (siderophore) produced by different strains of E. coli. It is a virulence factor enabling E. coli to sequester iron in iron-poor environments and helps bacteria in colonization inside the host. Aerobactin producing operon is a part of ColV plasmid of E. coli strains. Five genes are present on Aerobactin producing operon, four of them (iucA, iucB, iucC, iucD) are involved in Aerobactin synthesis and one (iutA) is responsible for transportation of Aerobactin.

Aerobactin Production
Part name Part type Part function
BBa_K3011001 Basic iucA, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011002 Basic iucB, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011003 Basic iucC, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011004 Basic iucD, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011005 Basic iutA, involve in Aerobactin transportation in E. coli strains. It is ferric-aerobactin receptor.

Metal Ion Chelator

We have used the cytoplasmic domain of Human Copper transporter as a divalent ion chelator. This is to be used as an analogue for the Aerobactin gene for all the experimental purposes in the project. It is known that this protein has the capability to chelate a variety of divalent ion.

Part Number Part type Part Function
BBa_K3011012 Basic Metal Ion chelator

NsrR binding site

NsrR is a nitric oxide (NO) sensitive transcriptional repressor. In absence of NO it binds to a particular DNA sequence as a homodimer and block transcription. In presence of NO, NsrR binds to NO using Fe-S cluster, due to this NsrR can’t bind to DNA.

23bp NsrR binding site is basically a 11bp inverted repeat with a spacing of 1bp.

Different Promoters NsrR binding sites
ytfE aagatgcatttaaaatacatctt
hmp aagatgcatttgagatacatcaa
hmp-2 aagaaccatttacattgcagggc
ygbA aagatgtaatataaatacatctt
ygbA-2 aagatgctgttttgcagcttttg
hcp aacatgtatattaaatataactt
hcp-2 aagttgcatgaaaaatccctttt
Part name Part type Part function
BBa_K3011006 Basic NsrR binding site.

References

  1. DNA Sequence of a ColV Plasmid and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Escherichia coli Strains. DOI: 10.1128/JB.188.2.745-758.2006
  2. NsrR targets in the Escherichia coli genome - new insights into DNA sequence requirements for binding and a role for NsrR in the regulation of motility. DOI: 10.1111/j.1365-2958.2009.06799.x
  3. Escherichia coli A2363 plasmid pAPEC-O2-ColV, complete sequence