Difference between revisions of "Team:IISER Kolkata/Basic Part"

Line 61: Line 61:
 
              
 
              
 
                 <div id="container">
 
                 <div id="container">
 +
<h1 class="heading">Basic parts</h1>
 +
 +
<section class="sec white">
 +
<h3>Genes involve in Aerobactin biosynthesis</h3>
 +
<p>Aerobactin is an iron chelator (siderophore) produced by different strains of E. coli. It is a virulence factor enabling E. coli to sequester iron in iron-poor environments and helps bacteria in colonization inside the host. Aerobactin producing operon is a part of ColV plasmid of E. coli strains. Five genes are present on Aerobactin producing operon, four of them (iucA, iucB, iucC, iucD) are involved in Aerobactin synthesis and one (iutA) is responsible for transportation of Aerobactin.</p>
 +
<figure>
 +
<img class="bigimage" src="img/"/>
 +
<figcaption>Aerobactin Production</figcaption>
 +
</figure>
 +
<table class="tabular">
 +
  <tr>
 +
    <th>Part name</th>
 +
    <th>Part type</th>
 +
    <th>Part function</th>
 +
  </tr>
 +
  <tr>
 +
    <td>BBa_K3011001</td>
 +
    <td>Basic</td>
 +
    <td>iucA, involve in Aerobactin biosynthesis in E. coli strains.</td>
 +
  </tr>
 +
  <tr>
 +
    <td>BBa_K3011002</td>
 +
    <td>Basic</td>
 +
    <td>iucB, involve in Aerobactin biosynthesis in E. coli strains.</td>
 +
  </tr>
 +
  <tr>
 +
    <td>BBa_K3011003</td>
 +
    <td>Basic</td>
 +
    <td>iucC, involve in Aerobactin biosynthesis in E. coli strains.</td>
 +
  </tr>
 +
  <tr>
 +
    <td>BBa_K3011004</td>
 +
    <td>Basic</td>
 +
    <td>iucD, involve in Aerobactin biosynthesis in E. coli strains.</td>
 +
  </tr>
 +
  <tr>
 +
    <td>BBa_K3011005</td>
 +
    <td>Basic</td>
 +
    <td>iutA, involve in Aerobactin transportation in E. coli strains. It is ferric-aerobactin receptor.</td>
 +
  </tr>
 +
</table>
 +
</section>
 +
 +
<section class="sec white">
 +
<h3>NsrR binding site</h3>
 +
<p>NsrR is a nitric oxide (NO) sensitive transcriptional repressor. In absence of NO it binds to a particular DNA sequence as a homodimer and block transcription. In presence of NO, NsrR binds to NO using Fe-S cluster, due to this NsrR can’t bind to DNA.</p>
 +
<p>23bp NsrR binding site is basically a 11bp inverted repeat with a spacing of 1bp. </p>
 +
<table class="tabular">
 +
  <tr>
 +
    <th>Different Promoters</th>
 +
    <th>NsrR binding sites</th>
 +
  </tr>
 +
  <tr>
 +
    <td>ytfE</td>
 +
    <td>aagatgcatttaaaatacatctt</td>
 +
  </tr>
 +
  <tr>
 +
    <td>hmp</td>
 +
    <td>aagatgcatttgagatacatcaa</td>
 +
  </tr>
 +
  <tr>
 +
    <td>hmp-2</td>
 +
    <td>aagaaccatttacattgcagggc</td>
 +
  </tr>
 +
  <tr>
 +
    <td>ygbA</td>
 +
    <td>aagatgtaatataaatacatctt</td>
 +
  </tr>
 +
  <tr>
 +
    <td>ygbA-2</td>
 +
    <td>aagatgctgttttgcagcttttg</td>
 +
  </tr>
 +
  <tr>
 +
    <td>hcp</td>
 +
    <td>aacatgtatattaaatataactt</td>
 +
  </tr>
 +
  <tr>
 +
    <td>hcp-2</td>
 +
    <td>aagttgcatgaaaaatccctttt</td>
 +
  </tr>
 +
</table>
 +
<table class="tabular">
 +
  <tr>
 +
    <th>Part name</th>
 +
    <th>Part type</th>
 +
    <th>Part function</th>
 +
  </tr>
 +
  <tr>
 +
    <td>BBa_K3011006</td>
 +
    <td>Basic</td>
 +
    <td>NsrR binding site.</td>
 +
  </tr>
 +
</table>
 +
</section>
 +
 +
<section class="sec white">
 +
<h3>References</h3>
 +
<ol>
 +
<li>DNA Sequence of a ColV Plasmid and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Escherichia coli Strains. DOI: 10.1128/JB.188.2.745-758.2006</li>
 +
<li>NsrR targets in the Escherichia coli genome - new insights into DNA sequence requirements for binding and a role for NsrR in the regulation of motility. DOI:10.1111/j.1365-2958.2009.06799.x</li>
 +
<li><a href="https://www.ncbi.nlm.nih.gov/nuccore/NC_007675" target="_blank">https://www.ncbi.nlm.nih.gov/nuccore/NC_007675</a></li>
 +
</ol>
 +
</section>
 
                          
 
                          
 
                 </div>
 
                 </div>

Revision as of 14:48, 14 October 2019

Basic parts

Genes involve in Aerobactin biosynthesis

Aerobactin is an iron chelator (siderophore) produced by different strains of E. coli. It is a virulence factor enabling E. coli to sequester iron in iron-poor environments and helps bacteria in colonization inside the host. Aerobactin producing operon is a part of ColV plasmid of E. coli strains. Five genes are present on Aerobactin producing operon, four of them (iucA, iucB, iucC, iucD) are involved in Aerobactin synthesis and one (iutA) is responsible for transportation of Aerobactin.

Aerobactin Production
Part name Part type Part function
BBa_K3011001 Basic iucA, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011002 Basic iucB, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011003 Basic iucC, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011004 Basic iucD, involve in Aerobactin biosynthesis in E. coli strains.
BBa_K3011005 Basic iutA, involve in Aerobactin transportation in E. coli strains. It is ferric-aerobactin receptor.

NsrR binding site

NsrR is a nitric oxide (NO) sensitive transcriptional repressor. In absence of NO it binds to a particular DNA sequence as a homodimer and block transcription. In presence of NO, NsrR binds to NO using Fe-S cluster, due to this NsrR can’t bind to DNA.

23bp NsrR binding site is basically a 11bp inverted repeat with a spacing of 1bp.

Different Promoters NsrR binding sites
ytfE aagatgcatttaaaatacatctt
hmp aagatgcatttgagatacatcaa
hmp-2 aagaaccatttacattgcagggc
ygbA aagatgtaatataaatacatctt
ygbA-2 aagatgctgttttgcagcttttg
hcp aacatgtatattaaatataactt
hcp-2 aagttgcatgaaaaatccctttt
Part name Part type Part function
BBa_K3011006 Basic NsrR binding site.

References

  1. DNA Sequence of a ColV Plasmid and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Escherichia coli Strains. DOI: 10.1128/JB.188.2.745-758.2006
  2. NsrR targets in the Escherichia coli genome - new insights into DNA sequence requirements for binding and a role for NsrR in the regulation of motility. DOI:10.1111/j.1365-2958.2009.06799.x
  3. https://www.ncbi.nlm.nih.gov/nuccore/NC_007675