Ⅰ Overview
Currently, T7 promoter is one of the most widely used promoters for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter has proven quite effective, in some cases, we need modified T7 promoters with even higher efficiency of protein expression to meet specific demands. Hence, we tried to transform the wild-type T7 promoter to get modified T7 promoters with increased strength.
T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+1) and extends from -17 to +6. As reported in some papers, the sequence specificity of T7 promoter is so strong that some point mutations between positions -11 and -7 may make T7 promoter fail to work[1]. Thus, with the help of previous research, we carefully chose the site which would be mutated by PCR[2]. These sites distribute in the range from -3 to +6. We mutated these sites by adding variable bases to primers (taatacgactcactatagggaga → taatacgactcacWNNNgSRRNN), and screened for stronger mutants.
Ⅱ Result
To test the function of mutant promoters, we chose eGFP as our reporter, and added a lac operator behind the promotor to control transcription starts simultaneously. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added 0.5 mM IPTG to induce the expression of GFP in strains BL21(DE3) for 4 hours. By assessing the absolute fluorescence and OD600, we can conclude the relative strength of all promoters. We screened out four mutants with higher intensity.
Figure 1. Strength of wildtype T7 promoter and mutant promoters. Relative fluorescent intensity is standardized with fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) per OD600. The intensity of the four mutants was significantly higher than that of the wild type.
As we can see from the figure, our mutant promoters showed largely increased strength compared with wild type T7 promoter. Therefore, our mutant promoters offer users more opportunity to control the expression of protein using T7 promoter and permit higher levels of target protein expression to be obtained.
Ⅲ Protocol
1. Use BamHI and XhoI to insert eGFP fragment into pET28 plasmid.
2. Linearize pET28-eGFP plasmid by PCR.
(WT: F-CCCGCTGCAGTAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA / R- GCGGTGGACTGCAGCAACTCAGCTTCCTTTCGGGCT;
Mu: F-CCCGCTGCAGTAATACGACTCACWNNNGSRRNNGGAATTGTGAGCGGATAACAA / R- GCGGTGGACTGCAGCAACTCAGCTTCCTTTCGGGCT)
3. Cyclization the plasmid by PstI and ligase.
4. Transform the plasmids into E. coli BL21(DE3), add 20μl 100mM IPTG to the plate before coating the plate.
5. Incubate at 37℃ and observe colony color to screen for strong mutants preliminarily.
6. Pick greener single colonies, add the colonies into 3ml Lb, incubate at 37℃ in a shaker for 6-8h to dilute the IPTG introduced when picking single colonies.
7. Add 10μl germ solution from last step into 3ml Lb, incubate at 37℃ in a shaker until OD600 reaches 0.6.
8. Add IPTG to final concentrations 0.5mM, and induce for 4h at 18℃.
9. Measure the fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) and OD600.
Reference
[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.
[2] Paul S, Stang A, Lennartz K, Tenbusch M, Uberla K. Selection of a T7 promoter mutant with enhanced in vitro activity by a novel multi-copy bead display approach for in vitro evolution[J]. Nucleic Acids Research, 2013, 41(1):e29.