Team:Western Canada/Experiments


Aim 1: Design and assembly of parts into plasmid backbone

All parts will be ordered from Twist Bioscience as synthetic DNA blocks. Primers with extensions corresponding to regions flanking the insertion site on the shuttle vector pAGE 2.0 (Table 1) will be ordered from Integrated DNA Technologies.

Table 1. Primers to amplify each part for insertion into the pAGE 2.0 vector plasmid by homology cloning.

 Part  Forward primer  Reverse primer
 CsgA:SpyCatcher  iGEM1_F: CTGTTTCTCCATACCCGTTTTTTGTTTAACTTTAAGAAGG  iGEM1_Ralt: CAAAATTATTTCTAGCCCAAAATCAATGATGATGATGATGATGAATATGAGC
 Laccase:SpyTag-B  iGEM5_F: GGCTGTAATGCCCGTTCGCTC  iGEM2_R: CAAAATTATTTCTAGCCCAAAATCAATGATGATGATGATGATGC
 Cutinase:SpyTag  iGEM2_F: CTGTTTCTCCATACCCGTTTTGACGGCG  iGEM2_R: CAAAATTATTTCTAGCCCAAAATCAATGATGATGATGATGATGC
 Laccase:SpyTag-A  iGEM2_F: CTGTTTCTCCATACCCGTTTTGACGGCG  iGEM5_R: GGGCATTACAGCCATTGAGCAAAC
 SpyTag:Laccase-A  iGEM2_F: CTGTTTCTCCATACCCGTTTTGACGGCG  iGEM4_R: ATCGCCAAACCAGCCCACG
 SpyTag:Laccase-B  iGEM4_F: CTGGTTTGGCGATACGTTGCTG  iGEM2_Ralt: CAAAATTATTTCTAGCCCAAAATCAATGATGATGATGATGATGTACCGTAAACCC
 SpyCatcher:CsgA  iGEM1_F: CTGTTTCTCCATACCCGTTTTTTGTTTAACTTTAAGAAGG  iGEM1_R: CAAAATTATTTCTAGCCCAAAATCAGTACTGATGAGC
 SpyTag:Cutinase  iGEM2_F: CTGTTTCTCCATACCCGTTTTGACGGCG  iGEM3_R: CAAAATTATTTCTAGCCCAAAATCAATGATGATGATGATGATGGGC

The vector pAGE 2.0 will be amplified as three overlapping fragments (A, B, and C) with the primers in (Table 2). This plasmid contains a chloramphenicol resistance marker for selection in E. coliand a histidine biosynthesis complementation gene for selection in the histidine-auxotrophic yeast strain S. cerevisiae VL6-48.

Table 2. Primers to amplify the pAGE 2.0 vector plasmid in three fragments.

 Plasmid Fragment  Forward primer  Reverse primer
 A  BK806F: TTTTGGGCTAGAAATAATTTTGTTTAACTTTAAGAAGGAG  BK573R: GCCAGCCCAGCGGCGAGGGCAACCAGCTCGACTATATTACCCTGTTATCCCTAGCGTAAC
 B  BK574F: CGCTCCGGCCTGCCTCAATCTCGTTGGCCATGACCGAGCAACGACTGCACCGGATGGTTC  BK574R: GAGAATATTCAGGCCAGTTATGCTTTCTGGCCTGTAACAAAGGACATTAAGTAAAGACAG
 C  BK575F: CATTCTTAAGGAACTTGAAAAGCCAGCACCCTGATGCGACCTCGTTTTAGTCTACGTTTA  BK805R: AAACGGGTATGGAGAAACAGTAGAGAGTTGCGATAAAAAG

Aim 2: Assaying protein expression and efficiency of enzyme export

To assay the export of enzymes to the media, western blotting will be used. Transformed bacteria will be grown O/N to OD600=1 in LB-CHL and cultures will be centrifuged to separate the pellet and the supernatant. Supernatant will be treated with trichloroacetic acid, the obtained precipitate, containing the secreted proteins, will be washed with acetone and resuspended in SDS sample buffer. The E. coli cells will be lysed using SDS-lysis buffer. SDS-PAGE will be performed on the E. coli lysate and supernatant samples, and the proteins will be transferred to a nitrocellulose membrane. Membranes will be blotted with an anti-FLAG 1o antibody and a fluorochrome-conjugated 2o antibody. If western blot results indicate no protein export but presence of the protein in the cell lysate, the secretion constructs will be re-designed to change the relative location of SpyCatcher and the enzyme.


Aim 3: Assaying enzymatic activity of the exported enzyme

The enzymatic activity of secreted cutinase will be determined using an assay based on the cleavage of 4-methylumbelliferyl butyrate (MUB). E. coli O/N cultures grown to OD600=1.0 will be centrifuged and the supernatant will be added to 96 well-plate. MUB in phosphate-citrate buffer will be then added to initiate the reaction, and the fluorescence of cleavage product will be measured using a plate reader. The activity of the secreted laccase will be assayed in the similar way but using oxidation of 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) and LB medium supplemented with 0.1 mM CuSO4.


Aim 4: Assaying curli fiber production and growing a composite biofilm

To assay whether the SpyTag-fused curli fibers are produced successfully, a biofilm growth assay adapted from Uhlich et al., Botyanszki et al., and Chapman et al., will be used1,2,3. E. coli MC 4100 ΔcsgA, transformed with the csgA-SpyTag, construct will be first grown in LB- CHL O/N. Bacterial cultures will be centrifuged and the supernatant will be aspirated. Bacterial pellets will be then re-suspended in a nutrient-poor YESCA-CHL medium and grown for 24-48 hours at 25 oC to allow curli fibers to form. Bacterial cultures will then be centrifuged, supernatant will be aspirated, and pellets will be re-suspended in PBS buffer. Expression of curli fibers will be quantified using Congo Red staining and by measuring absorbance at 490 nm, as described by Botyanszki et al1.

To form a composite biofilm between the MC 4100 ΔcsgA strain transformed with a csgA-SpyTag construct and MC1000 strain transformed with the secretion-SpyCatcher-enzyme construct, both strains will be inoculated in separate LB-CHL cultures and grown O/N. Two cultures will then be combined, mixed, pelleted and re-suspended in YESCA medium. The obtained combined culture will then be aliquoted to wells on a flat-bottom 24-well cell culture plate and a biofilm will be grown at 25 oC, with gentle shaking. Prolonged growth in a well-plate will allow biofilm to adhere to the plastic and achieve high density.


Aim 5: Assaying activity of curli-immobilized enzymes

The supernatant will be decanted from the wells and the biofilms will be washed with PBS buffer to remove all remaining growth media. This step will also remove all enzymes that have been secreted, but not attached to the curli fibers. The buffer will then be mixed with either MUB or ABTS, depending on which enzyme is being assayed, and added to the wells. After the reaction is complete, the buffer will be removed from the wells, transferred to a different well plate, and the concentration of the reaction products will be determined using a plate reader.


Aim 6: Assaying degradation of an environmental pollutant using the composite catalytic biofilm

As a final step to confirm the feasibility of removing environmental pollutants using the proposed approach, we will assay degradation of 17β-estradiol and diclofenac. Both of those compounds are regarded as emerging environmental pollutants and have been previously shown to be degraded by laccase4. 17β-estradiol and diclofenac will be dissolved in an aqueous buffer of approximately neutral pH over a range of concentrations, with some particulate and organic matter, to approximate the conditions of untreated sewage. This solution will be added to the catalytic biofilm, as described in Aim 5, and incubated for varying amounts of time. Degradation of 17β-estradiol and diclofenac will be monitored using HPLC4.



References

  1. Yousra Turki, Y. et al. Biofilms in bioremediation and wastewater treatment: characterization of bacterial community structure and diversity during seasons in municipal wastewater treatment process. Environ. Sci. Pollut. Res. 24, 3519–3530 (2017).

  2. Hammer, N. D., Schmidt, J. C. & Chapman, M. R. The curli nucleator protein, CsgB, contains an amyloidogenic domain that directs CsgA polymerization. Proc. Natl. Acad. Sci. U. S. A. 104, 12494–9 (2007).

  3. Lloret, L. et al. Laccase-catalyzed degradation of anti-inflammatories and estrogens. Biochem. Eng. J. 51, 124–131 (2010).

  4. Osma, J. F., Toca-Herrera, J. L. & Rodríguez-Couto, S. Cost analysis in laccase production. J. Environ. Manage. 92, 2907–2912 (2011).