Team:UI Indonesia/Experiments

EXPERIMENTS

Protocols

Polymerase Chain Reaction Protocol

Materials:
  1. PCR mix contain:
    • Q5® High-Fidelity 2X Master Mix
    • Forward Primer
    • Reverse Primer
    • Nuclease Free Water
    • DNA Template
  2. 0.2 ml PCR Tube
  3. T100TM Thermal Cycler
Methods:
  1. Make the PCR Mix inside a microtube:
    Component 100 µl RXN Final Concentration
    10 µM Forward Primer 5 µl 0.5 µM
    10 µM Reverse Primer 5 µl 0.5 µM
    Q5®High-Fidelity 2X Master Mix 50 µl 1X
    DNA Template 10 µl 1 ng/µl
    Nuclease Free Water to 30 µl -
  2. Aliquot the mix into 10 PCR tubes 0.2 ml
  3. Put PCR tubes inside T100TM Thermal Cycler with these settings:
    Step Temperature Time
    Initial denaturation 98oC 30 sec
    Annealing (30 cycles) 98oC 10 sec
    50-60oC 30 sec
    72oC 30-60 sec
    Final Extension 71oC 2 min

Electrophoresis Protocol

Materials:
  1. Agarose 0.8 g
  2. EcoDyeTM Nucleic Acid Staining Solution
  3. Gel Loading Dye, Purple (6X)
  4. Quick-Load® Purple 1kb Plus DNA Ladder
  5. TAE Buffer 0.5X
  6. Agarose Well Mold
  7. MUPID-exU Horizontal Electrophoresis System
  8. DNA Sample
Methods:
  1. Make the agarose 0.8 g:
    1. Mix 0.8 g of agarose with 100ml TAE buffer 0.5X
    2. Put the mix inside microwave for 5 minutes
    3. Put 2 µl EcoDye into the mixture
    4. Wait till warm
    5. Mold the agarose well and wait until it harden
  2. Fill MUPID-exU with TAE Buffer 0.5X
  3. Put the agarose inside MUPID-exU Horizontal Electrophoresis System
  4. Fill the first well with Quick-Load® Purple 1kb Plus DNA Ladder
  5. Re-suspense 3µl of DNA sample with 1µl of Gel Loading Dye, Purple (6X)
  6. Insert the resuspended DNA sample into the rest of the well
  7. Set the voltage of MUPID-exU into 100V for 30 minutes
  8. Read the result in Gel Doc® XR

Desalting and Concentrating DNA Solution Protocol

Materials:
  1. Buffer QX1
  2. QIAEX II Gel Extraction Kit
  3. PE Buffer
  4. EB Water 0.3X
  5. Sodium Acetate 3M
  6. Centrifuge
  7. Vortex Mixer
  8. DNA Sample
Methods:
  1. Add 3 volumes of Buffer QX1 to 1 volume of sample
  2. Add 10µl of Sodium Acetate 3M
  3. Resuspend QIAEX II by vortexing
  4. Add 10µl of QIAEX II for every 5µg of DNA and mix
  5. Incubate at room temperature for 10 minutes and make sure QIAEX II in in suspension
  6. Centrifuge 12.000rpm for 1 minute
  7. Remove supernatant
  8. Wash the pellet twice using 500µl of Buffer PE
  9. Air dry pellet for 5 minutes
  10. Elute DNA using 20µl EB Water 0.3X and resuspend pellet by vortexing
  11. Incubate DNA at room temperature for fragments ≤4kb and 50C for fragments >4kb
  12. Incubate for 5 minutes
  13. Centrifuge at 12.000 rpm for 1 minute
  14. Carefully transfer the supernatant into a clean tube
  15. Repeat step 10-14 and combine the elutes

SDS Polyacrylamide Gel Electrophoresis (SDS-PAGE) Protocol

Materials:
  1. Polyacrylamide 30%
  2. Sodium dodecyl sulfate 10% (SDS 10%)
  3. Tris-HCl 1.5 M pH 8.8 solution
  4. Tris-HCl 0.5 M pH 6.8 solution
  5. Ammonium persulfate 10% (APS 10%)
  6. TEMED
  7. Tank Buffer 10% contains:
    • Tris base
    • Glycine
    • SDS
  8. Bio-Rad Mini-PROTEAN Tetra Cell
Methods:
  1. Set up the glass plates using Bio-Rad Mini-PROTEAN Tetra Cell kit based on the Bio-Rad protocol.
  2. Prepare the resolving and stacking gel solution according to the desired concentration with the help of Bio-Rad Mini PROTEAN Tetra Cell kit
    Resolving Gel
    Components Gel Concentration (%)
    15 12 10 7
    Tris-HCl 1.5M pH 8.8 1.75 ml 1.75 ml 1.75 ml 1.75 ml
    Polyacrylamide 30% 3.5 ml 2.8 ml 2.333 ml 1.633 ml
    Distilled water 1.638 ml 2.338 ml 2.8047 ml 3.5047 ml
    SDS 10% 70 µl 70 µl 70 µl 70 µl
    APS 10% 35 µl 35 µl 35 µl 35 µl
    TEMED 7 µl 7 µl 7 µl 7 µl

    Stacking Gel
    Components Volume
    Tris-HCl 0.5 M pH 6.8 0.75 ml
    Polyacrylamide 30% 0.4 ml
    Aquades 1.812 ml
    SDS 10% 30 µl
    APS 10% 15 µl
    TEMED 3 µl
  3. Prepare the protein sample mixed with loading buffer by heating at 100°C for 10 minutes then centrifuge at 12.000 rpm for 1 minute.
  4. Put the gel into the SDS PAGE Tank with Bio-Rad Mini PROTEAN Tetra Cell kit.
  5. Fill the SDS PAGE Tank with tank buffer 10%.
  6. Insert 15-20 µl of each sample into the wells.
  7. Install the lid and connect it to the power supply.
  8. Adjust the settings to 150 V, 400 mA and run for 60-90 minutes.
  9. Open the glass carefully and put the gel into distilled water.
  10. Stain the gel with PageBlue Staining Solution for approximately 1 hour.
  11. Wash the gel by soaking it in distilled water overnight.

NEBuilder® HiFi DNA Assembly Transformation Protocol

Materials:
  1. Competent cells
  2. SOC
  3. Selection plates
Methods:
  1. Thaw competent cells on ice.
  2. Add 2 µl of the chilled assembly product to the competent cells.
  3. Place mixture on ice for 30 minutes.
  4. Heat shock at 42°C for 30 seconds.
  5. Transfer tube to ice for 2 minutes.
  6. Add 950 µl of SOC medium to the tube.
  7. Incubate the tube at 37°C for 60 minutes in a shaker.
  8. Warm selection plates to 37°C.
  9. Spread 100 µl of the cells onto the selection plates.
  10. Incubate overnight at 37°C.

NEBuilder® HiFi DNA Assembly Protocol

Materials:
  1. NEBuilder® HiFi DNA Assembly Master Mix 2X
  2. Deionized H2O
  3. Insert fragments
  4. Vector
Methods:
  1. Set up the following reaction on ice
    Components Fragments
    Fragments 0.03-0.2 pmols* (X µl)
    NEBuilder® HiFi DNA Assembly Master Mix 10 µl
    Deionized H2O 10-X µl
    Total 20 µl
    2. Incubate sample at 50°C for 15 minutes*
  2. Store samples on ice or -20°C for subsequent transformation.
  3. Transform sample to competent cells using NEBuilder® HiFi DNA Assembly Transformation Protocol.

*recommended for 2-3 fragments assembly


MagneHis™ Protein Purification Protocol

Materials:
  1. MagneHis™ Binding/Wash Buffer
  2. MagneHis™ Elution Buffer
  3. FastBreak™ Cell Lysis Reagent, 10X
  4. MagneHis™ Ni-Particles
  5. DNase I (lyophilized)
  6. NaCl solution 5M
  7. Bacterial cell culture sample
  8. Magnetic stand
Methods:
  1. Lysis the 1 ml of bacterial cell cultures by adding 110 µl fo FastBreak™ Cell Lysis Reagent.
  2. Add 1 µl of lyophilized DNase I per milliliter of original culture volume.
  3. Incubate with shaking for 10-20 minutes at room temperature.
  4. Add 500 mM NaCl to HQ-tagged protein lysate.
  5. Vortex the MagneHis™ Ni-Particles to a uniform suspension.
  6. Add 30 µl of MagneHis™ Ni-Particles to 1.1 ml of cell lysate.
  7. Invert tube to mix approximately 10 times and incubate at room temperature for 2 minutes.
  8. Place the tube in the appropriate magnetic stand for 30 seconds.
  9. Remove the tube from the magnetic stand then add 150 µl of MagneHis™ Binding/Wash Buffer to the MagneHis™ Ni-Particles, pipet to mix.
  10. Place the tube in the appropriate magnetic stand for 30 seconds.
  11. Repeat the wash step 2 times more.
  12. Remove the tube from the magnetic stand then add 100 µl of MagneHis™ Elution Buffer, pipet to mix.
  13. Incubate for 1-2 minutes at room temperature then place in a magnetic stand.
  14. Take the supernatant containing the purified protein.

Bacteria Transformation Protocol

Competent Cell Preparation Step
  1. Take one single colony of bacteria (without plasmid) and inoculate into 20-25 mL of Luria-Bertani (LB) medium in a 50 mL Conical Centrifuge tube and shake in the incubator (37°) for 14-16 hours
  2. Prepare the following ingredients afterwards:
    1. LB medium, autoclave, put in refrigerator
    2. 0.1 M CaCl2 , autoclave before use, put in 4°C freezer
    3. 0.1 M MgCl2 , autoclave before use, put in 4°C freezer
    4. SOC medium in room temperature
    5. Freezed centrifuge rotor, and a lot of tips and microfuge tube
  3. From each of the overnighted LB medium, take 100 μL of bacterial culture and place it into new 20 mL of LB medium in a 50 mL conical centrifugal tube and shake in the incubator (37°C) for 2 hours
  4. Harvest the cells by centrifuge at 3500 rpm speed for 10 minutes at 4°C (Starting from this point, all steps and material must be in 4°C or below temperature
  5. Decant the supernatant and resuspend the pellet with 4 mL (~⅕ of initial medium volume) of cold (4°C) autoclaved MgCl2. Incubate the tube with resuspended pellet in an ice box for 15-20 minutes
  6. Harvest the cells by centrifuge at 3500 rpm speed for 10 minutes at 4°C
  7. Decant the supernatant and resuspend the pellet with 400 μL (~1/50 of initial medium volume) of cold (4°C) autoclaved CaCl2. Incubate the tube with resuspended pellet in an ice box for 1 hour
  8. Harvest the cells by centrifuge at 3500 rpm speed for 10 minutes at 4°C.
  9. Decant the supernatant and resuspend the pellet with 200 μL (~1/100 of initial medium volume) of cold (4°C) autoclaved CaCl2.
  10. Aliquote 50 μL into the cold microfuge tube. Competent cells are ready for transformation.
  11. Store the competent cells in the microfuge tube with addition of a ¼ volume of the 75% autoclaved glycerol in the -80°C freezer if it is not used immediately.
Transformation Step
  1. Add the plasmid (minimal amount of 10 ng/μL) or ligation result (minimal amount of 100 ng/μL) with 5 μL volume into 50 μL of competent cell. If using frozen competent cells, put the tube into the ice box until it melts, then add the plasmid or ligation result.
  2. Incubate in the ice box for 1 hour (While waiting for the incubation, prepare the SOC medium).
  3. Do heat shock by placing the incubated tube into the 38°C water bath for 90 seconds.
  4. Immediately move the tube into the ice box again for 60 seconds.
  5. Put the tube out of the ice box into the temperature room rack and add 200 μL of SOC medium.
  6. Incubate the tube in the incubator at 150-200 rpm for 1 hour at 37°C. (Make sure the tube is appropriate position to get good aeration)
  7. For the plasmid with disrupted LacZ expression by the insert (e.g. pKS plasmid), add 40 μL 100 mM IPTG and 40 μL X-gal 20 mg/mL
  8. For plasmid, take 50 μL of the incubated competent cells and spread into the LB agar selection plate
  9. For ligation result, use 2 LB agar plate, take 50 μL of the incubated competent cells and spread into the LB agar selection plate, take the rest and spread into other plate

Bacteria Plasmid Isolation Protocol

  1. Grow bacterial culture in 15 mL conical centrifuge tube with 4-5 mL Luria-Bertani (LB) medium with inoculating the replica result, incubate at 150-200 rpm for 14-16 hours at 37°C.
  2. Harvest the cells by centrifuge the tube at 3500 rpm speed for 10 minutes.
  3. Decant the supernatant by vertically flip the tube.
  4. Resuspend the pellet with 125 μL (250 μL for bigger scale) P1 buffer, and then shake with hands).
  5. Add 125 μL of P2 buffer and mix until well for 7-8 times. (Do not do this step for more than 5 minutes).
  6. Add 175 μL of N3 buffer and mix it immediately, gently homogenate for 7-8 times.
  7. Centrifuge the tube in balance to avoid vibration at 12000 rpm for 1 minute at 4°C.
  8. Take all of the supernatant and put into the blue column with micropipette. (Make sure to not take the pellet at all because it will clog the column membrane)
  9. Centrifuge the tube in balance to avoid vibration at 12000 rpm for 1 minute at 4°C.
  10. Take all the fluid below the blue column, and put it again into the blue column.
  11. Centrifuge the tube in balance to avoid vibration at 12000 rpm for 1 minute at 4°C (after this step, all of the plasmid trapped in the membrane)
  12. Remove all the fluid below the blue column. Wash the blue column by adding 200 μL PB buffer.
  13. Centrifuge the tube in balance to avoid vibration at 12000 rpm for 1 minute at 4°C.
  14. Remove all the fluid below the blue column. Wash the blue column by adding 500 μL PE+Ethanol buffer (Mixture of PE Buffer and Ethanol with 1:4 ratio).
  15. Centrifuge the tube in balance to avoid vibration at 12000 rpm for 1 minute at 4°C.
  16. Remove all the fluid below the blue column, and repeat Step 15 once again to make sure there is no buffer left in the membrane (PE+Ethanol Buffer can cause damage to the plasmid).
  17. Remove all the fluid below the blue column, put the blue column into the new microfuge tube.
  18. Add 20 μL of ⅓ EB Buffer (Mixture of EB Buffer and Sigma water with 1:3 ratio) to the blue column. Centrifuge the tube in balance to avoid vibration at 12000 rpm for 1 minute at 4°C.
  19. Add another 15 μL of ⅓ EB Buffer to the blue column. Centrifuge the tube in balance to avoid vibration at 12000 rpm for 1 minute at 4°C.
  20. Remove the blue column, and store the isolated plasmid in the 4°C freezer.

Bacteria Expressoin Protocol

  1. Three single colony of bacteria which has been successfully transform is incubated into 4mL of LB medium each (containing respective antibiotic with 1:1000 ratio) and shake in the incubator (37°C) for 14-16 hours.
  2. From each of the overnighted LB medium, take 100 μL of bacterial culture and place it into new 10 ml of Terrific Broth (TB) medium (containing respective antibiotic with 1:1000 ratio)
  3. Shake in the incubator (37°C) for 2 hour.
  4. After 2 hours, isolate 1 ml of liquid medium for SDS-PAGE.
  5. Add IPTG (if the plasmid contains lac promoter) to create final concentration of 1mM.
  6. Every hour after IPTG is added, isolate 1 ml of the liquid medium for SDS-PAGE.
  7. Keep collecting the liquid medium for the next 4 hours
  8. Perform SDS-PAGE for collected each sample (see SDS-PAGE protocol)
  9. Perform fluorescence and absorbance (Abs 600) measurement using GloMax Multi Detection System by Promega for the remaining samples

Experiments

We conducted three kinds of experiments:

  1. Characterization of part Bba_K769001, which consists of GFP gene controlled under OmpC promoter, later will be referred as part OG
  2. Manufacture of the HB-EGF/EnvZ-based diphtheria diagnostic tool system, and
  3. Improvement and characterization of part Bba_K2607000, later will be referred as part DT18 and DT19 for the old one and improved one respectively.

The manufacturing the HB-EGF/EnvZ-based diphtheria diagnostic tool system was the main purpose of our project. The characterization of part OG was carried out to accomplish the bronze medal criteria, while the improvement and characterization of part DT18 was intended to achieve gold medal criteria as well as becoming our project components.

Characterization of Part Ompc/GFP (OG): Bba_K769001

Part I: Transformation of Plasmid-containing Part OG

We used part OG that was already provided in iGEM Distribution Kit 2019. This part was already integrated in plasmid pSB1C3 so we could directly transform it into E. coli competent cells. We used three types of bacteria for transformation which are BL21, DH5α, and TOP10. We used chloramphenicol as an antibiotic for transformation selection as plasmid pSB1C3 contains chloramphenicol resistance gene (CmR).

Part II: Expression of GFP

After we got the desired bacteria that contain our plasmids, we then grow each type of bacteria in LB-medium with different NaCl concentrations to observe the level of GFP expression under each of the treatments. The experiments were conducted in duplicate to ensure accuracy. The NaCl concentrations that we used were 85.5 mM (low salt), 171 mM (normal LB broth), 256.6 mM 342 mM, and 427 mM. To confirm the presence of GFP protein in the bacterial culture, we conducted SDS-PAGE for each type of bacterial culture and treatments. The emission of GFP was measured at 520 nm using fluorometry (Glomax Multi-detection system) and calculated by using standard curve obtained from iGEM kit for fluorescence measurement. The GFP expressed was calculated in MEFL/E. coli particles.. Using the same equipment and conditions during the measurement of the standard curve, we measure the GFP expression of each treatment. All the values obtained from the fluorometer are then processed by the Excel formula provided by iGEM.

Manufacturing of HB-EGF/EnvZ-based Diphtheria Diagnostic Tool System

Part I: Assembly of Part HE into pSB1C3-containing Part OG

We assembled part HE into pSB1C3-OG by Gibson Assembly method. Before the Gibson Assembly reaction was conducted, the pSB1C3-OG was amplified using primers with overlapping sequences that fit the part HE end sequences so that it could be compatible with Gibson Assembly method. The sequences of primers used for amplifying pSB1C3-OG are shown in Table 2.1.

Table 2.1 Primer pairs for amplifying pSB1C3-OG.

Primer Sequence
pSB1C3_fwd aggctaggtggaggctcagtgCGCGGCCGCTTCTAGAGTCC
pSB1C3_rev aggtcaggcggaatggcacTTCCAGAAATCATCCTTAGCGA

The product of gibson assembly reaction was directly transformed into bacterial competent cells. After getting the bacteria that contain our desired plasmid, we isolate the plasmids and sequencing was conducted to see whether part HE was inserted in the right position or not.

Part II: Expression of HBE-GF/EnvZ Chimeric Protein

Once we obtained the plasmid pSB1C3 HE-OG as the product from Gibson Assembly reaction, we transformed it into TOP10, DH5a and BL21 for characterization purposes. We took a single colony from each of the transformed bacteria and grown it in overnight culture. Liquid medium of these E.coli strain were then incubated into 3 types of medium (normal TB medium, normal LB medium, LB medium with reduced salt) in 1:100 ratio. All of these experiments were performed in triplicate. The medium were incubated for 2 hours and IPTG was added to each medium. After 4 hours post IPTG induction, all samples were collected. To confirm the presence of HBE-GF/EnvZ protein, we conducted SDS-PAGE for each bacterial culture.

Part III: Testing the HBEGF/EnvZ - OmpC/GFP Binding Potential with Heparin

Heparin (Inviclot 5000 iu/ml) was diluted using LB medium to make stock solutions of 1:10, 1:100, and 1:1000. The heparin was then added to all of the samples to create heparin:broth ratio of 1:100, 1:1000, 1:10000 and then incubated for 60 minutes in a 37°C shaker. The result will be read by using Glomax Multi-detection System. Fluorescence will be read at emission 520 nm and absorbance was read at Abs 600 nm.

Part IV: Consideration of using TOP10 bacteria in LB medium for characterizing HBEGF/EnvZ - OmpC/GFP

There are several considerations why we use TOP10 bacteria in LB medium for HE-OG characterization with heparin. Firstly, our modelling was designed based on K12 bacteria which includes TOP10. We did not include DH5a because the results of the OMPC-GFP (BBa_K769001) expression in DH5a showed inconsistencies when the sodium concentration is increased. TB medium and low salt medium was also omitted to exclude any conditions which may affect the basal metabolism of the bacteria because these mediums are modified medium that is less suitable for optimal bacteria environment. Therefore, in order to measure the HE-OG expression for the very first time, we would like to use optimal environment (LB medium) as well as TOP10 bacteria to maximize the result.

Improvement and characterization of Part DT18: Bba_K2607000

Part I: Assembly of Part DT18 and DT19 into pQE80L

We assembled part Diphtox, which will be called as DT18 , and DT18 + RFP, which will be called as DT19 , into plasmid pQE80L by Gibson Assembly method. For DT18, prior to Gibson Assembly reaction, we linearized plasmid pQE80L using restriction endonuclease EcoRI then we amplified part DT18 using primers with overlapping sequences that fit into the linearized plasmid pQE80L sequences so that it could be compatible with Gibson Assembly method. Table 2 shows the sequence of primers used for amplifying part DT18.

Table 2. Primer pairs for amplifying part DT18.
Primer Sequence
DT18_fwd cggataacaatttcacacagTGCCACCTGACGTCTAAG
DT18_rev gggtaccgagctcgcatgcgATTACCGCCTTTGAGTGAG

For DT19, three kinds of primer were used, one for amplifying DT19 and one pair for amplifying plasmid pQE80L. One primer for DT18 was used in order to remove the adapter sequences from Twist Bioscience and prefix sequence so that the distance between promoter and RBS after part DT19 assembled into plasmid would not too distant. Primer pairs for pQE80L contain overlapping sequences that fit into the part DT19 so that it could be compatible for Gibson Assembly reaction. Table 3 shows the sequences of primer pairs used in amplifying part DT19 and pQE80L.

Table 3. Primer pairs for amplifying part DT19 and pQE80L
Primer Sequence
DT19_fwd tGACAGCGAAAGAGGAGAAACGCTGTCATGAACGGTGTTCA
DT19_rev CACTGAGCCTCCACCTAGCCTTAAGCGAGTGCCGTATTA
pQE80L_fwd aggctaggtggaggctcagtgAAAGAGGAGAAATTAACTAT
pQE80L_rev gcgtttctcctctttcgctgtcaatgTGAATTCTGTGTGAAAT

The products of Gibson Assembly of DT18 and DT19 were directly transformed into TOP10. For DT18, transformation was done by using TOP10 bacteria in medium containing antibiotic ampicillin for selection. Confirmation was done on 19 survived-colonies by using PCR colony method using primer pairs shown in Table 4

Table 4. Primer pairs for PCR colony of DT18 transformation result.
Primer Sequence
DT18 colony_fwd CTTCTGCCACATGAGCGGAT
DT18 colony_rev TGGTGATGGTGATGGTGAGA

For DT19, the plasmids that had been successfully transformed into bacterial competent cells were isolated and sequenced for confirmation whether the part DT19 was inserted in the right position.

Part II: Expression of DT18 and DT19

Based on the sequencing result, DT19 was not successfully transformed into bacteria whereas DT18 was successfully transformed into TOP10 bacteria based on the PCR colony result. We later conducted the expression for DT18. Plasmids isolated from the initial transformation, which has been successfully confirmed by PCR colony,were collected. These plasmids were then used to transformed into BL21 and DH5α bacteria. Each type of bacteria were grown in TB and LB medium. The medium were incubated for 2 hours and IPTG was added to each medium. After 4 hours post IPTG induction, all samples were collected. To confirm the presence of DiphTox protein, we conducted MagneHis™ protein purification and SDS-PAGE for each bacterial culture and MagneHis™ results.