Team:KCL UK/Measurement

Capacity
MENU
Home
People
Team Members
Collaborations
Attributions
Project
Description
Design
Experiments
Notebook
Contribution
Results
Demonstrate
Improve
Parts
Parts Overview
Basic Parts
Composite Parts
Part Collection
Safety
Human Practices
Human Practices
Public Engagement
Modelling
Measurement
Model
Software
JUDGING FORM ⇗

Measurement

As measurement is a foundational aspect of science and engineering, we ensured to carry out precise and accurate measurements throughout our project. The data that we obtained in our wet lab is presented in a way that indicates not only the important aspect of the data but our measurement repetition. We made sure that all important measurements were performed in duplicates and we also used positive and negative controls where necessary.

Rigorous Characterisation of Parts

We recognise that it was importance to test the validity of our generated parts across a range of conditions and thus we made sure that we sequenced our DNA parts at each step before proceeding to the next. We also thought about the best methods to acquire quantitative values in standardised units. We analysed bacterial cell growth by measuring the optical density (OD600) and the GFP expression by analysing fluorescence (excitation 485 nm, emission 520 nm) and performed all measurements using back clear bottom 96-well plates and the PHERAstar FS (BMG Labtech) 96-well plate reader. All recorded results were normalised to the blank control, LB media with antibiotics, and average results of two duplicate samples were presented for further analysis. We also ensured to make our raw data available on a spreadsheet that allows for access by others to guide further investigation. The results of our data are presented as detailed tables, alongside subplots which display highlighted portions of the data with the range of figures.

In dry lab, we developed tools that conduct quantitative calculations of biological data. We designed two software tools to conduct quantitative calculations of biological data. The CapsidOptimizer utilises datasets from the VIPERdb database (http://viperdb.scripps.edu) to determine new measurements for optimized viral capsids. Alongside this, the CapsidBuilder incorporates wet lab constructs in order to determine transaltion efficiencies of theoretical constructs using equations that model ribsome-binding dynsamics and mRNA-folding dynamics.

Primers

BBa_G00100 VF2 sequencing primer: TGCCACCTGACGTCTAAGAA
BBa_G00101 VR sequencing primer: ATTACCGCCTTTGAGTGAGC
KCL_iGEM_6F: AGCTGAATTCGCGGCCGCTTCTAGAG

Synthetic BioBricks:

Materials:

Chemicals and Solvents:

  1. DNA ladder, 1kb plus (Promega, cat. No. G571A)
  2. DNA ladder, 100bp (Promega, cat. No. G210A)
  3. Ampicillin (Fisher Scientific-Chemical, cat. No. 1273-7149)
  4. Carbenecilin (Fisher Scientific-Bioreagents, cat. No. 10438923)
  5. Kanamycin (Fisher Scientific-Bioreagents, cat. No. 11815024)
  6. Chloramphenicol (Fisher Scientific-Chemical, cat. No. BP904-100)
  7. LB Media Miller (Fisher Scientific-Bioreagents, cat. No. BP906-5)
  8. LB Agar Miller (Fisher Scientific-Bioreagents, cat. No. 10081163)
  9. H2O (Sterile) (Thermo Scientific, cat. No. R0581)
  10. Redsafe nucleic acid stain (gel red) (NBS biological Ltd, cat. No. NBS-SV)
  11. Agarose (Sigma-Aldrich, cat. No. NBS-AG100)
  12. Glycerol (Sigma-Aldrich, cat. No. G9012)
  13. Ethanol (Sigma-Aldrich, cat. No. UN1170)
  14. MgCl2 (Fisher Scientific, cat. BP358-212)
  15. CaCl2 (Acros organic, cat. No. 207780025)
  16. Isopropanol (Fisher Scientific, cat. No. 1679597)
  17. EDTA (Fisher Scientific-Bioreagents, cat. No. 17892)
  18. Tris Base (Fisher Scientific-Bioreagents, BP120-500)
  19. Acetic Acid glacial (BDH, cat. No. 27013BV)

Enzymes:

Restrictions endonucleases:
EcoRI (Promega, cat. No. A601A)
XbaI (Promega, cat. No. R618A)
SpeI (NEB, cat. No. R0133S)
PstI (Promega, R611A)
T4 DNA ligase (Promega, M180A)
DNA polymerase

Kits:

  1. Gel extraction kit (Qiagen, cat. No. 28704)
  2. Plasmid prep kit (BioBasic, cat. No. BS414-100Preps)
  3. PCR prep kit (Qiagen, cat. No. 201443)
  4. 2X PCR premix (Thermo Scientific, cat. No. K1061)

Primers:

Invitrogen by Thermo Fisher Scientific:
Forward (cat. No. 377292 V3519 (B03))
Reverse (cat. No. 377292 V3519 (B04))

Bacterial strains and vectors:

  1. E. coli cloning strain DH5alpha (New England Biolab, cat. No. C3040H)
  2. E. coli cloning strain XL1Blue (Stratagene, cat. No. 200249)
  3. pSB1C3
  4. pSB4K5

Equipment:

  1. Thermocycler Dyad (BIO-RAD, discontinued)
  2. Tabletop microcentrifuge (Biofuge, cat. No. D35720)
  3. Agarose gel electrophoresis equipment (BIO-RAD, 1704406, 1704466)
  4. Gel illuminator (Nippon Genetics, cat. No. FG-05)
  5. Vortex mixer (WhirliMixer, discontinued, no serial number)
  6. Water bath (Techne, serial number DB200/3)
  7. Culture tube
  8. Culture flask
  9. Multiwell plates
  10. PCR reaction tube, 0.2ml
  11. Nanodrop ND-1000 spectrophotometer (ThermoScientific, cat. No. ND-Lite-PR)
  12. Temperature controlled shaking incubator (Stuart, series SI500)
  13. Temperature controlled incubator (Function line, discontinued)
  14. Laboratory Fridge (Beko, UL483AP)
  15. -20°C Freezer (Lec, TU55144)
  16. -80°C Freezer (Beko, BZ31)
  17. Pipette tips
  18. Culture plates (Thermo Fisher, cat. No. 263991)
  19. Eppendorf tubes (Tubeone, cat. No. S1615-5510)

Experimental Design:

Step 1. Preparation of plasmid pSB1C3 containing BBa_J23100 promoter

  1. Transform XL1Blue with pSB1C3 containing BBa_J23100 2018 iGEM distribution Kit plate 1 Well 20I and plate on chloramphenicol containg LB agar plates>/li>
  2. Inoculate single colony into 10 ml LB media containing chloramphenicol and grow ON.
  3. Isolate plasmid and store at -20 degrees C.
  5. Digest some of the plasmid DNA with SpeI-PstI restriction enzymes, run on 1% agarose gel, purify and store at -20 degrees C.

Step 2. PCR amplification of sRNA without TBR and restriction enzyme digestion.

  1. PCR amplify No TBR sRNA constructs synthesised by the IDT with KCL_iGEM_6F and KCL_iGEM_6R primers.
  2. Run on 2% agarose gel, purify.
  3. Digest PCR amplified sRNA constructs with XbaI-PstI restriction enzymes, run on 2% agarose gel, purify and use for ligation.

Step 3. Constructing pSB1C3 plasmid composed of BBa_J23100 promoter and sRNA with NO TBR.

  1. Ligate pSB1C3 plasmid containing BBa_J23100 and digested with SpeI-PstI restriction enzymes (prepared in step 1) with PCR amplified sRNA constructs digested with XbaI-PstI restriction enzymes (prepared in step 2).
  2. Transform XL1Blue and plate on chloramphenicol containing LB agar plates.
  3. Inoculate single colony O/N in 10 ml lb media and isolate plasmids.
  4. Sequence plasmids and store DNA at -20 degrees C.

Step 4. Site directed mutagenesis to create an expression pSB1C3 plasmid composed of BBa_J23100 promoter and sRNA with B0032 RBS TBR.

  1. Use plasmids created in step 3, forward primers; GcvBFor,Spot42For, RprAFor, reverse primer SDMsRNARev and QuikChange II XL Site-Directed Mutagenesis Kit.
  2. Transform XL1Blue chemically competent E.coli and plate on chloramphenicol containing agar plates.
  3. Inoculate single colonies ON in 10 ml LB media containing chloramphenicol.
  4. Isolate plasmids, sequence (using BBa_G00100 VF2 sequencing primer) and store DNA at -20 degrees.

Step 5. Plasmid pSB1C3 containing BBa_J23100 promotor digestion with EcoRI-PstI restriction enzymes.

  1. Digest pSB1C3 plasmid containing BBa_J23100 promotor isolated in step 1 with EcoRI-PstI restriction enzymes, run on 1% agarose gel, purify and store at -20 degrees C.

Step 6. sRNA with BBa_J23100 promoter and B0034 RBS TBR PCR amplification and restriction enzyme digestion.

  1. PCR amplify sRNA constructs containing BBa_J23100 promoter B0034 RBS TBR and sRNA scaffolds synthesised by the IDT with KCL_iGEM_6F and KCL_iGEM_6R primers.
  2. Run on 2% agarose gel, purify.
  3. Digest PCR amplified sRNA constructs with EcoRI-PstI restriction enzymes, run on 2% agarose gel, purify and use for ligation

Step 7. Constructing pSB1C3 plasmid composed of BBa_J23100 promoter and sRNA with B0034 RBS TBR.

  1. Ligate pSB1C3 plasmid containing BBa_J23100 and digested with EcoRI-PstI restriction enzymes (prepared in step 5) with PCR amplified sRNA constructs digested with EcoRI-PstI restriction enzymes (prepared in step 6).
  2. Transform XL1Blue and plate on chloramphenicol containing LB agar plates
  3. Inoculate single colony O/N in 10 ml lb media and isolate plasmids
  4. Sequence plasmids and store DNA at -20 degrees C.

Step 8. Prepare pSB1C3 plasmid containing promoter, RBS and GFP constructs for subcloning.

  1. Transform XL1Blue E.coli with pSB1C3 plasmid containing BBa_K608011 BioBrick(J23100 promoter, B0032 RBS and GFP) (iGEM 2019 distribution Kit plate 1 Well 5M) and pSB1C3 plasmid containing BBa_K608010 BioBrick(J23100 promoter, B0034 RBS and GFP) (iGEM 2019 distribution Kit plate 1 Well 5K)and plate on chloramphenicol containing LB agar plates and grow ON at 37oC
  2. Inoculate single colony into 10 ml LB media containing chloramphenicol and grow ON.
  3. Isolate plasmid and store at -20 degrees C.
  4. Digest some of the plasmid DNA with EcoR-PstI restriction enzymes, run on 2% agarose gel, purify smaller band and store at -20 degrees C to be used for ligation.

Prepare pSB4K5 plasmid:

  1. Transform XL1Blue E.coli with pSB4K5 plasmid containing BBa_J04450 BioBrick(iGEM 2019 distribution Kit Plate 6 Well 6G)and plate on kanamycin containing LB agar plates and grow ON at 37 degrees C
  2. Inoculate single colony into 10 ml LB media containing kanamycin and grow ON.
  3. Isolate plasmid and store at -20 degrees C.
  4. Digest some of the plasmid DNA with EcoRI-PstI restriction enzymes, run on 1% agarose gel, purify larger band and store at -20 oC to be used for ligation.

Step 10. Subclone promoter, RBS and GFP constructs from pSB1C3 plasmid backbone into pSB4K5 plasmid backbone.

  1. Ligate pSB4K5 plasmid backbone digested EcoRI-PstI restriction enzymes (prepared in step 9) with EcoRI-PstI restriction enzymes digested BioBrick BBa_K608011 and BBa_K608010 (prepared in step 8)
  2. Transform XL1Blue and plate on kanamycin containing LB agar plates
  3. Inoculate single colony O/N in 10 ml lb media and isolate plasmids.
  4. Sequence plasmids (using BBa_G00100 VF2 sequencing primer) and store DNA at -20 degrees C.

Step 11. E. coli cell analysis.

  1. Co-transfect Xl1Blue E. coli with pSB1C3 plasmid containing appropriate sRNA and pSB4K5 plasmid containing GFP and plate on LB agar plates containing both(chloramphenicol and kanamycin) antibiotics and grow ON.
  2. Inoculate single colony into 10 ml LB media containing two antibiotics and grow ON.
  3. Dilute 1/10 ON culture into fresh LB media with both antibiotic and grow at 37 oC taking 1 ml samples at 0, 1, 2, 3, 4, and 5 h intervals. Store samples on ice.
  4. Aliquot 200 ul of each sample into 96 well black plate with clear bottom and take measurements of OD 600 and fluorescence (GFP filters 485nm(ex) and 520nm(em)) using PHERAstar FS (BMG Labtech) 96 well plate reader.